ABCA3 Rabbit Polyclonal Antibody

ABCA3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCA3 Polyclonal Antibody
ES9419-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA3 Polyclonal Antibody
ES9419-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCA3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA3 Rabbit pAb
A6862-100ul 100 ul
EUR 308

ABCA3 Rabbit pAb
A6862-200ul 200 ul
EUR 459

ABCA3 Rabbit pAb
A6862-20ul 20 ul
EUR 183

ABCA3 Rabbit pAb
A6862-50ul 50 ul
EUR 223

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
DLR-ABCA3-Hu-48T 48T
EUR 517
  • Should the Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A3 (ABCA3) in samples from tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
DLR-ABCA3-Hu-96T 96T
EUR 673
  • Should the Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter A3 (ABCA3) in samples from tissue homogenates or other biological fluids.

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
RD-ABCA3-Hu-48Tests 48 Tests
EUR 521

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
RD-ABCA3-Hu-96Tests 96 Tests
EUR 723

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
RDR-ABCA3-Hu-48Tests 48 Tests
EUR 544

Human ATP Binding Cassette Transporter A3 (ABCA3) ELISA Kit
RDR-ABCA3-Hu-96Tests 96 Tests
EUR 756

ABCA3 Antibody
45789-100ul 100ul
EUR 252

ABCA3 Antibody
45789-50ul 50ul
EUR 187

ABCA3 Antibody
1-CSB-PA859942ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCA3. Recognizes ABCA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCA3 Antibody
DF9245 200ul
EUR 304
Description: ABCA3 Antibody detects endogenous levels of total ABCA3.

ABCA3 Antibody
ABD9245 100 ug
EUR 438

ABCA3 Conjugated Antibody
C45789 100ul
EUR 397

Anti-ABCA3 antibody
STJ28942 100 µl
EUR 277
Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death.

Anti-ABCA3 antibody
STJ190577 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA3

ABCA3 siRNA
20-abx906288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA3 siRNA
20-abx906289
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA3 Blocking Peptide
DF9245-BP 1mg
EUR 195

ABCA3 cloning plasmid
CSB-CL859942HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 630
  • Sequence: atggctgtgctcaggcagctggcgctcctcctctggaagaactacaccctgcagaagcggaaggtcctggtgacggtcctggaactcttcctgccattgctgttttctgggatcctcatctggctccgcttgaagattcagtcggaaaatgtgcccaacgccaccatctacccggg
  • Show more
Description: A cloning plasmid for the ABCA3 gene.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human)
4-PAD619Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3)

Human ABCA3 ELISA KIT
ELI-12192h 96 Tests
EUR 824

Mouse ABCA3 shRNA Plasmid
20-abx973911
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCA3 shRNA Plasmid
20-abx950013
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Abca3 ELISA KIT
ELI-49889m 96 Tests
EUR 865

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), APC
4-PAD619Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with APC.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), Biotinylated
4-PAD619Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), Cy3
4-PAD619Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), FITC
4-PAD619Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), HRP
4-PAD619Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), PE
4-PAD619Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with PE.

ATP Binding Cassette Transporter A3 (ABCA3) Polyclonal Antibody (Human), APC-Cy7
4-PAD619Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA3 (Asp1358~Phe1635)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A3 (ABCA3). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
20-abx005231
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
abx038096-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
20-abx128628
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
20-abx147857
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
20-abx171345
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

ATP Binding Cassette Transporter A3 (ABCA3) Antibody
20-abx320813
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-P180 Lamellar Body Protein/ABCA3 Antibody
PA2259 100ug/vial
EUR 294

ABCA3 ORF Vector (Human) (pORF)
ORF000022 1.0 ug DNA
EUR 95

Abca3 ORF Vector (Mouse) (pORF)
ORF037757 1.0 ug DNA
EUR 1572

Abca3 ORF Vector (Mouse) (pORF)
ORF037758 1.0 ug DNA
EUR 1572

ABCA3 ELISA Kit (Human) (OKCD01207)
OKCD01207 96 Wells
EUR 831
Description: Description of target: Plays an important role in the formation of pulmonary surfactant, probably by transporting lipids such as cholesterol. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 33 pg/mL

Abca3 sgRNA CRISPR Lentivector set (Mouse)
K4342901 3 x 1.0 ug
EUR 339

ABCA3 sgRNA CRISPR Lentivector set (Human)
K0016801 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit
E04A1130-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit
E04A1130-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 3(ABCA3) ELISA kit
E04A1130-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 3(ABCA3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4342902 1.0 ug DNA
EUR 154

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4342903 1.0 ug DNA
EUR 154

Abca3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4342904 1.0 ug DNA
EUR 154

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0016802 1.0 ug DNA
EUR 154

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0016803 1.0 ug DNA
EUR 154

ABCA3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0016804 1.0 ug DNA
EUR 154

ABCA3 Protein Vector (Mouse) (pPB-C-His)
PV151026 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-N-His)
PV151027 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-HA)
PV151028 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-His)
PV151029 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-C-His)
PV151030 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPB-N-His)
PV151031 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-HA)
PV151032 500 ng
EUR 2848

ABCA3 Protein Vector (Mouse) (pPM-C-His)
PV151033 500 ng
EUR 2848

ABCA3 Protein Vector (Human) (pPB-His-MBP)
PV318666 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPB-His-GST)
PV318667 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPB-C-His)
PV000085 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPB-N-His)
PV000086 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPM-C-HA)
PV000087 500 ng
EUR 329

ABCA3 Protein Vector (Human) (pPM-C-His)
PV000088 500 ng
EUR 329

Recombinant ATP Binding Cassette Transporter A3 (ABCA3)
4-RPD619Hu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99758
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.4kDa
  • Isoelectric Point: 8.5
Description: Recombinant Human ATP Binding Cassette Transporter A3 expressed in: E.coli

Abca3 3'UTR Luciferase Stable Cell Line
TU101136 1.0 ml Ask for price

Abca3 3'UTR GFP Stable Cell Line
TU151136 1.0 ml Ask for price

Abca3 3'UTR Luciferase Stable Cell Line
TU200039 1.0 ml Ask for price

Abca3 3'UTR GFP Stable Cell Line
TU250039 1.0 ml Ask for price

ABCA3 3'UTR GFP Stable Cell Line
TU050036 1.0 ml
EUR 4617

ABCA3 3'UTR Luciferase Stable Cell Line
TU000036 1.0 ml
EUR 4617

Human ATP Binding Cassette Transporter A3 (ABCA3) Protein
20-abx167134
  • EUR 718.00
  • EUR 286.00
  • EUR 2249.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

ABCA3 Rabbit Polyclonal Antibody

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Business Theme