ABCA9 Rabbit Polyclonal Antibody

ABCA9 Rabbit Polyclonal Antibody

Order Now:

ABCA9 Polyclonal Antibody

ABP57650-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880
  • Applications tips:
Description: A polyclonal antibody for detection of ABCA9 from Human. This ABCA9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880

ABCA9 Polyclonal Antibody

ABP57650-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880
  • Applications tips:
Description: A polyclonal antibody for detection of ABCA9 from Human. This ABCA9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880

ABCA9 Polyclonal Antibody

ES9422-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCA9 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCA9 Polyclonal Antibody

ES9422-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCA9 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal ABCA9 Antibody (Internal)

APG01402G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCA9 (Internal). This antibody is tested and proven to work in the following applications:

ABCA9 Antibody

45791-100ul 100ul
EUR 252

ABCA9 Antibody

45791-50ul 50ul
EUR 187

ABCA9 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

ABCA9 Antibody

DF9248 200ul
EUR 304
Description: ABCA9 Antibody detects endogenous levels of total ABCA9.

ABCA9 antibody

70R-50791 100 ul
EUR 244
Description: Purified Polyclonal ABCA9 antibody

ABCA9 Antibody

ABD9248 100 ug
EUR 438

Polyclonal Goat Anti-ABCA9 Antibody

AMM04852G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ABCA9 . This antibody is tested and proven to work in the following applications:

ABCA9 Polyclonal Antibody, HRP Conjugated

A66091 100 µg
EUR 570.55
Description: fast delivery possible

ABCA9 Polyclonal Antibody, FITC Conjugated

A66092 100 µg
EUR 570.55
Description: reagents widely cited

ABCA9 Polyclonal Antibody, Biotin Conjugated

A66093 100 µg
EUR 570.55
Description: Ask the seller for details

ABCA9 Conjugated Antibody

C45791 100ul
EUR 397

Anti-ABCA9 antibody

STJ71603 100 µg
EUR 359

Anti-ABCA9 antibody

STJ190580 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA9


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCA9 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABCA9 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABCA9 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABCA9 Blocking Peptide

DF9248-BP 1mg
EUR 195

ABCA9 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

ABCA9 cloning plasmid

CSB-CL812864HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 489
  • Sequence: atggggtggcctgatgaaaaaagcatggatgaattggatttgaactattcaatagacgcagtgagagtcatctttactgataccttctcctaccatttgaagttttcttggggacatagaatccccatgatgaaagagcacagagaccattcagctcactgtcaagcagtgaatga
  • Show more
Description: A cloning plasmid for the ABCA9 gene.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9)

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9)

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9)

Mouse Abca9 ELISA KIT

ELI-12228m 96 Tests
EUR 865

Human ABCA9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ABCA9 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-35056h 96 Tests
EUR 824

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), APC

  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), Cy3

  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), FITC

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), HRP

  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), PE

  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1423~Leu1590)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1422~Leu1589)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCA9 (Glu1416~Leu1583)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody

abx432261-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

ABCA9 ORF Vector (Human) (pORF)

ORF000024 1.0 ug DNA
EUR 95

Abca9 ORF Vector (Mouse) (pORF)

ORF037767 1.0 ug DNA
EUR 1572

ABCA9 ELISA Kit (Mouse) (OKCD00398)

OKCD00398 96 Wells
EUR 857
Description: Description of target: May play a role in monocyte differentiation and lipid homeostasis.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ABCA9 sgRNA CRISPR Lentivector set (Human)

K0017401 3 x 1.0 ug
EUR 339

Abca9 sgRNA CRISPR Lentivector set (Mouse)

K3744001 3 x 1.0 ug
EUR 339

ABCA9-AS1 ORF Vector (Human) (pORF)

ORF015159 1.0 ug DNA Ask for price

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit

E04A1135-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit

E04A1135-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit

E04A1135-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0017402 1.0 ug DNA
EUR 154

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0017403 1.0 ug DNA
EUR 154

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0017404 1.0 ug DNA
EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3744002 1.0 ug DNA
EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3744003 1.0 ug DNA
EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3744004 1.0 ug DNA
EUR 154

ABCA9 Protein Vector (Mouse) (pPB-C-His)

PV151066 500 ng
EUR 2725

ABCA9 Protein Vector (Mouse) (pPB-N-His)

PV151067 500 ng
EUR 2725

ABCA9 Protein Vector (Mouse) (pPM-C-HA)

PV151068 500 ng
EUR 2725

ABCA9 Protein Vector (Mouse) (pPM-C-His)

PV151069 500 ng
EUR 2725

ABCA9 Protein Vector (Human) (pPB-His-MBP)

PV318690 500 ng
EUR 329

ABCA9 Protein Vector (Human) (pPB-His-GST)

PV318691 500 ng
EUR 329

ABCA9 Protein Vector (Human) (pPB-C-His)

PV000093 500 ng
EUR 329

ABCA9 Protein Vector (Human) (pPB-N-His)

PV000094 500 ng
EUR 329

ABCA9 Protein Vector (Human) (pPM-C-HA)

PV000095 500 ng
EUR 329

ABCA9 Protein Vector (Human) (pPM-C-His)

PV000096 500 ng
EUR 329

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)

  • EUR 426.14
  • EUR 217.00
  • EUR 1323.04
  • EUR 507.68
  • EUR 915.36
  • EUR 348.00
  • EUR 3157.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IUA7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human ATP Binding Cassette Transporter A9 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)

  • EUR 453.02
  • EUR 224.00
  • EUR 1423.84
  • EUR 541.28
  • EUR 982.56
  • EUR 366.00
  • EUR 3409.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8K449
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse ATP Binding Cassette Transporter A9 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)

  • EUR 461.98
  • EUR 227.00
  • EUR 1457.44
  • EUR 552.48
  • EUR 1004.96
  • EUR 372.00
  • EUR 3493.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4ADE1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat ATP Binding Cassette Transporter A9 expressed in: E.coli

Abca9 3'UTR Luciferase Stable Cell Line

TU101143 1.0 ml Ask for price

Abca9 3'UTR GFP Stable Cell Line

TU151143 1.0 ml Ask for price

Abca9 3'UTR Luciferase Stable Cell Line

TU200046 1.0 ml Ask for price

Abca9 3'UTR GFP Stable Cell Line

TU250046 1.0 ml Ask for price

ABCA9 3'UTR GFP Stable Cell Line

TU050042 1.0 ml
EUR 1521

ABCA9 3'UTR Luciferase Stable Cell Line

TU000042 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ABCA9 Rabbit Polyclonal Antibody