ABCA9 Rabbit Polyclonal Antibody

ABCA9 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCA9 Polyclonal Antibody
ABP57650-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880 Applications tips:
Description: A polyclonal antibody for detection of ABCA9 from Human. This ABCA9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880

ABCA9 Polyclonal Antibody
ABP57650-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880 Applications tips:
Description: A polyclonal antibody for detection of ABCA9 from Human. This ABCA9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880

ABCA9 Polyclonal Antibody
ABP57650-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880 Applications tips:
Description: A polyclonal antibody for detection of ABCA9 from Human. This ABCA9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCA9 protein at amino acid sequence of 800-880

ABCA9 Polyclonal Antibody
A66090	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Polyclonal ABCA9 Antibody (Internal)
APG01402G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCA9 (Internal). This antibody is tested and proven to work in the following applications:

ABCA9 Antibody
ABD9248	Lifescience Market	100 ug	EUR 438

ABCA9 antibody
70R-50791	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal ABCA9 antibody

ABCA9 Antibody
45791-100ul	SAB	100ul	EUR 252

ABCA9 Antibody
45791-50ul	SAB	50ul	EUR 187

ABCA9 Antibody
DF9248	Affbiotech	200ul	EUR 304
Description: ABCA9 Antibody detects endogenous levels of total ABCA9.

ABCA9 Antibody
1-CSB-PA812864LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal Goat Anti-ABCA9 Antibody
AMM04852G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ABCA9 . This antibody is tested and proven to work in the following applications:

ABCA9 Polyclonal Antibody, HRP Conjugated
A66091	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

ABCA9 Polyclonal Antibody, FITC Conjugated
A66092	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ABCA9 Polyclonal Antibody, Biotin Conjugated
A66093	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ABCA9 Conjugated Antibody
C45791	SAB	100ul	EUR 397

Anti-ABCA9 antibody
STJ71603	St John's Laboratory	100 µg	EUR 359

Anti-ABCA9 antibody
STJ190580	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ABCA9

ABCA9 siRNA
20-abx906301	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCA9 siRNA
20-abx906302	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCA9 Antibody, HRP conjugated
1-CSB-PA812864LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ABCA9 Antibody, FITC conjugated
1-CSB-PA812864LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ABCA9 Antibody, Biotin conjugated
1-CSB-PA812864LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ABCA9. Recognizes ABCA9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ABCA9 Blocking Peptide
20-abx063666	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ABCA9 Blocking Peptide
DF9248-BP	Affbiotech	1mg	EUR 195

ABCA9 cloning plasmid
CSB-CL812864HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 489 Sequence: atggggtggcctgatgaaaaaagcatggatgaattggatttgaactattcaatagacgcagtgagagtcatctttactgataccttctcctaccatttgaagttttcttggggacatagaatccccatgatgaaagagcacagagaccattcagctcactgtcaagcagtgaatga Show more
Description: A cloning plasmid for the ABCA9 gene.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human)
4-PAD649Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9)

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse)
4-PAD649Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9)

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat)
4-PAD649Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9)

Mouse ABCA9 shRNA Plasmid
20-abx981101	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Abca9 ELISA KIT
ELI-12228m	Lifescience Market	96 Tests	EUR 865

Human ABCA9 ELISA KIT
ELI-35056h	Lifescience Market	96 Tests	EUR 824

Human ABCA9 shRNA Plasmid
20-abx957016	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), APC
4-PAD649Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), Biotinylated
4-PAD649Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), Cy3
4-PAD649Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), FITC
4-PAD649Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), HRP
4-PAD649Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), PE
4-PAD649Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), APC
4-PAD649Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), Biotinylated
4-PAD649Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), Cy3
4-PAD649Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), FITC
4-PAD649Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), HRP
4-PAD649Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), PE
4-PAD649Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), APC
4-PAD649Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), Biotinylated
4-PAD649Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), Cy3
4-PAD649Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), FITC
4-PAD649Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with FITC.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), HRP
4-PAD649Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with HRP.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), PE
4-PAD649Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with PE.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Human), APC-Cy7
4-PAD649Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1423~Leu1590) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD649Mu01-APC-Cy7	Cloud-Clone	EUR 628.00 EUR 7258.00 EUR 1912.00 EUR 842.00 EUR 344.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1422~Leu1589) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Polyclonal Antibody (Rat), APC-Cy7
4-PAD649Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCA9 (Glu1416~Leu1583) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter A9 (ABCA9). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx130555	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx130556	Abbexa	EUR 467.00 EUR 133.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx130557	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx147865	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx008345	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
20-abx308571	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody
abx432261-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

ABCA9 ORF Vector (Human) (pORF)
ORF000024	ABM	1.0 ug DNA	EUR 95

Abca9 ORF Vector (Mouse) (pORF)
ORF037767	ABM	1.0 ug DNA	EUR 1572

ABCA9 ELISA Kit (Mouse) (OKCD00398)
OKCD00398	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: May play a role in monocyte differentiation and lipid homeostasis.By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (HRP)
20-abx308572	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (FITC)
20-abx308573	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ATP Binding Cassette Transporter A9 (ABCA9) Antibody (Biotin)
20-abx308574	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ABCA9 sgRNA CRISPR Lentivector set (Human)
K0017401	ABM	3 x 1.0 ug	EUR 339

Abca9 sgRNA CRISPR Lentivector set (Mouse)
K3744001	ABM	3 x 1.0 ug	EUR 339

ABCA9-AS1 ORF Vector (Human) (pORF)
ORF015159	ABM	1.0 ug DNA	Ask for price

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit
E04A1135-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit
E04A1135-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family A member 9(ABCA9) ELISA kit
E04A1135-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family A member 9(ABCA9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 1)
K0017402	ABM	1.0 ug DNA	EUR 154

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 2)
K0017403	ABM	1.0 ug DNA	EUR 154

ABCA9 sgRNA CRISPR Lentivector (Human) (Target 3)
K0017404	ABM	1.0 ug DNA	EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3744002	ABM	1.0 ug DNA	EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3744003	ABM	1.0 ug DNA	EUR 154

Abca9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3744004	ABM	1.0 ug DNA	EUR 154

ABCA9 Protein Vector (Human) (pPB-C-His)
PV000093	ABM	500 ng	EUR 329

ABCA9 Protein Vector (Human) (pPB-N-His)
PV000094	ABM	500 ng	EUR 329

ABCA9 Protein Vector (Human) (pPM-C-HA)
PV000095	ABM	500 ng	EUR 329

ABCA9 Protein Vector (Human) (pPM-C-His)
PV000096	ABM	500 ng	EUR 329

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)
4-RPD649Hu01	Cloud-Clone	EUR 426.14 EUR 217.00 EUR 1323.04 EUR 507.68 EUR 915.36 EUR 348.00 EUR 3157.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IUA7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.9kDa Isoelectric Point: Inquire
Description: Recombinant Human ATP Binding Cassette Transporter A9 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)
4-RPD649Mu01	Cloud-Clone	EUR 453.02 EUR 224.00 EUR 1423.84 EUR 541.28 EUR 982.56 EUR 366.00 EUR 3409.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8K449 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.9kDa Isoelectric Point: Inquire
Description: Recombinant Mouse ATP Binding Cassette Transporter A9 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter A9 (ABCA9)
4-RPD649Ra01	Cloud-Clone	EUR 461.98 EUR 227.00 EUR 1457.44 EUR 552.48 EUR 1004.96 EUR 372.00 EUR 3493.60	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: D4ADE1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.8kDa Isoelectric Point: Inquire
Description: Recombinant Rat ATP Binding Cassette Transporter A9 expressed in: E.coli

ABCA9 Protein Vector (Human) (pPB-His-MBP)
PV318690	ABM	500 ng	EUR 329

ABCA9 Protein Vector (Human) (pPB-His-GST)
PV318691	ABM	500 ng	EUR 329

ABCA9 Protein Vector (Mouse) (pPB-C-His)
PV151066	ABM	500 ng	EUR 2725

ABCA9 Protein Vector (Mouse) (pPB-N-His)
PV151067	ABM	500 ng	EUR 2725

ABCA9 Protein Vector (Mouse) (pPM-C-HA)
PV151068	ABM	500 ng	EUR 2725

ABCA9 Protein Vector (Mouse) (pPM-C-His)
PV151069	ABM	500 ng	EUR 2725

Abca9 3'UTR Luciferase Stable Cell Line
TU200046	ABM	1.0 ml	Ask for price

Abca9 3'UTR GFP Stable Cell Line
TU151143	ABM	1.0 ml	Ask for price

ABCA9 3'UTR Luciferase Stable Cell Line
TU000042	ABM	1.0 ml	EUR 1521

Abca9 3'UTR Luciferase Stable Cell Line
TU101143	ABM	1.0 ml	Ask for price

ABCA9 3'UTR GFP Stable Cell Line
TU050042	ABM	1.0 ml	EUR 1521

Abca9 3'UTR GFP Stable Cell Line
TU250046	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ABCA9 Rabbit Polyclonal Antibody