ABCB8 Rabbit Polyclonal Antibody

ABCB8 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCB8 Polyclonal Antibody
ABP57653-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590 Applications tips:
Description: A polyclonal antibody for detection of ABCB8 from Human, Mouse, Rat. This ABCB8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590

ABCB8 Polyclonal Antibody
ABP57653-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590 Applications tips:
Description: A polyclonal antibody for detection of ABCB8 from Human, Mouse, Rat. This ABCB8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590

ABCB8 Rabbit pAb
A2653-100ul	Abclonal	100 ul	EUR 308

ABCB8 Rabbit pAb
A2653-200ul	Abclonal	200 ul	EUR 459

ABCB8 Rabbit pAb
A2653-20ul	Abclonal	20 ul	EUR 183

ABCB8 Rabbit pAb
A2653-50ul	Abclonal	50 ul	EUR 223

ABCB8 Antibody
ABD9249	Lifescience Market	100 ug	EUR 438

ABCB8 antibody
70R-6464	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal ABCB8 antibody

ABCB8 Antibody
31025-100ul	SAB	100ul	EUR 252

ABCB8 Antibody
31025-50ul	SAB	50ul	EUR 187

ABCB8 Antibody
DF9249	Affbiotech	200ul	EUR 304
Description: ABCB8 Antibody detects endogenous levels of total ABCB8.

ABCB8 Antibody
1-CSB-PA985454	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ABCB8 Antibody
1-CSB-PA868325ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ABCB8 Antibody
1-CSB-PA868325ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCB8 Antibody
1-CSB-PA033367	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal ABCB8 Antibody (C-Term)
APG01419G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCB8 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal Abcb8 Antibody - middle region
APR14755G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Abcb8 - middle region. This antibody is tested and proven to work in the following applications:

ABCB8 Conjugated Antibody
C31025	SAB	100ul	EUR 397

Anti-ABCB8 Antibody
A08344	BosterBio	100uL	EUR 455
Description: Rabbit Polyclonal ABCB8 Antibody. Validated in WB and tested in Human.

Anti-ABCB8 antibody
STJ71642	St John's Laboratory	100 µg	EUR 260

Anti-ABCB8 antibody
STJ22457	St John's Laboratory	100 µl	EUR 277
Description: This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants.

Anti-ABCB8 antibody
STJ190581	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ABCB8

Abcb8/ Rat Abcb8 ELISA Kit
ELI-49468r	Lifescience Market	96 Tests	EUR 886

ABCB8 siRNA
20-abx900065	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCB8 siRNA
20-abx906317	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCB8 siRNA
20-abx906318	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ABCB8 Blocking Peptide
33R-2654	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCB8 antibody, catalog no. 70R-6464

ABCB8 cloning plasmid
CSB-CL868325HU1-10ug	Cusabio	10ug	EUR 713
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2157 Sequence: ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTC Show more
Description: A cloning plasmid for the ABCB8 gene.

ABCB8 cloning plasmid
CSB-CL868325HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2082 Sequence: ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTC Show more
Description: A cloning plasmid for the ABCB8 gene.

ABCB8 Blocking Peptide
DF9249-BP	Affbiotech	1mg	EUR 195

pCMV-SPORT6-ABCB8
PVT14439	Lifescience Market	2 ug	EUR 599

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human)
4-PAD638Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat)
4-PAD638Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), APC
4-PAD638Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), Biotinylated
4-PAD638Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), Cy3
4-PAD638Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), FITC
4-PAD638Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), HRP
4-PAD638Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), PE
4-PAD638Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat)
4-PAD638Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), APC
4-PAD638Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), Biotinylated
4-PAD638Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), Cy3
4-PAD638Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), FITC
4-PAD638Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), HRP
4-PAD638Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), PE
4-PAD638Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

Mouse ABCB8 shRNA Plasmid
20-abx978278	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat ABCB8 shRNA Plasmid
20-abx990359	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ABCB8 ELISA KIT
ELI-12201h	Lifescience Market	96 Tests	EUR 824

Mouse Abcb8 ELISA KIT
ELI-34983m	Lifescience Market	96 Tests	EUR 865

Human ABCB8 shRNA Plasmid
20-abx957672	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ABCB8 Recombinant Protein (Human)
RP036370	ABM	100 ug	Ask for price

ABCB8 Recombinant Protein (Human)
RP036373	ABM	100 ug	Ask for price

ABCB8 Recombinant Protein (Rat)
RP188549	ABM	100 ug	Ask for price

ABCB8 Recombinant Protein (Mouse)
RP113324	ABM	100 ug	Ask for price

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), APC-Cy7
4-PAD638Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Val472~Ser735) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), APC
4-PAD638Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAD638Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAD638Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), FITC
4-PAD638Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), HRP
4-PAD638Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), PE
4-PAD638Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), APC-Cy7
4-PAD638Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Gln714) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx130565	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx130566	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx130567	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
abx038131-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx005962	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx321079	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx322557	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
abx432263-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx242244	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx242245	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody
20-abx225001	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Abcb8 ORF Vector (Mouse) (pORF)
ORF037776	ABM	1.0 ug DNA	EUR 506

ABCB8 ORF Vector (Human) (pORF)
ORF012124	ABM	1.0 ug DNA	EUR 354

ABCB8 ORF Vector (Human) (pORF)
ORF012125	ABM	1.0 ug DNA	EUR 354

Abcb8 ORF Vector (Rat) (pORF)
ORF062851	ABM	1.0 ug DNA	EUR 506

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAD638Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ABCB8 (Gly468~Ala717) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ABCB8 sgRNA CRISPR Lentivector set (Human)
K0018501	ABM	3 x 1.0 ug	EUR 339

Abcb8 sgRNA CRISPR Lentivector set (Mouse)
K4691201	ABM	3 x 1.0 ug	EUR 339

Abcb8 sgRNA CRISPR Lentivector set (Rat)
K7379001	ABM	3 x 1.0 ug	EUR 339

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0018502	ABM	1.0 ug DNA	EUR 154

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0018503	ABM	1.0 ug DNA	EUR 154

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0018504	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4691202	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4691203	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4691204	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7379002	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7379003	ABM	1.0 ug DNA	EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7379004	ABM	1.0 ug DNA	EUR 154

ABCB8 Protein Vector (Human) (pPB-C-His)
PV048493	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPB-N-His)
PV048494	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPM-C-HA)
PV048495	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPM-C-His)
PV048496	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPB-C-His)
PV048497	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPB-N-His)
PV048498	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPM-C-HA)
PV048499	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPM-C-His)
PV048500	ABM	500 ng	EUR 481

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)
4-RPD638Hu01	Cloud-Clone	EUR 519.33 EUR 242.00 EUR 1672.48 EUR 624.16 EUR 1148.32 EUR 410.00 EUR 4031.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NUT2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.4kDa Isoelectric Point: Inquire
Description: Recombinant Human ATP Binding Cassette Transporter B8 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)
4-RPD638Mu01	Cloud-Clone	EUR 472.74 EUR 229.00 EUR 1497.76 EUR 565.92 EUR 1031.84 EUR 379.00 EUR 3594.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9CXJ4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse ATP Binding Cassette Transporter B8 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)
4-RPD638Ra01	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5RKI8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.3kDa Isoelectric Point: Inquire
Description: Recombinant Rat ATP Binding Cassette Transporter B8 expressed in: E.coli

ABCB8 Protein Vector (Human) (pPB-His-MBP)
PV318742	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Human) (pPB-His-GST)
PV318743	ABM	500 ng	EUR 481

ABCB8 Protein Vector (Mouse) (pPB-C-His)
PV151102	ABM	500 ng	EUR 1065

ABCB8 Rabbit Polyclonal Antibody