ABCB8 Rabbit Polyclonal Antibody

ABCB8 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCB8 Polyclonal Antibody

ABP57653-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of ABCB8 from Human, Mouse, Rat. This ABCB8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590

ABCB8 Polyclonal Antibody

ABP57653-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590
  • Applications tips:
Description: A polyclonal antibody for detection of ABCB8 from Human, Mouse, Rat. This ABCB8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCB8 protein at amino acid sequence of 510-590

ABCB8 Rabbit pAb

A2653-100ul 100 ul
EUR 308

ABCB8 Rabbit pAb

A2653-200ul 200 ul
EUR 459

ABCB8 Rabbit pAb

A2653-20ul 20 ul
EUR 183

ABCB8 Rabbit pAb

A2653-50ul 50 ul
EUR 223

ABCB8 Antibody

ABD9249 100 ug
EUR 438

ABCB8 antibody

70R-6464 50 ug
EUR 467
Description: Rabbit polyclonal ABCB8 antibody

ABCB8 Antibody

31025-100ul 100ul
EUR 252

ABCB8 Antibody

31025-50ul 50ul
EUR 187

ABCB8 Antibody

DF9249 200ul
EUR 304
Description: ABCB8 Antibody detects endogenous levels of total ABCB8.

ABCB8 Antibody

1-CSB-PA985454
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ABCB8 Antibody

1-CSB-PA868325ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

ABCB8 Antibody

1-CSB-PA868325ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ABCB8 Antibody

1-CSB-PA033367
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCB8. Recognizes ABCB8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal ABCB8 Antibody (C-Term)

APG01419G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCB8 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal Abcb8 Antibody - middle region

APR14755G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Abcb8 - middle region. This antibody is tested and proven to work in the following applications:

ABCB8 Conjugated Antibody

C31025 100ul
EUR 397

Anti-ABCB8 Antibody

A08344 100uL
EUR 455
Description: Rabbit Polyclonal ABCB8 Antibody. Validated in WB and tested in Human.

Anti-ABCB8 antibody

STJ71642 100 µg
EUR 260

Anti-ABCB8 antibody

STJ22457 100 µl
EUR 277
Description: This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants.

Anti-ABCB8 antibody

STJ190581 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCB8

Abcb8/ Rat Abcb8 ELISA Kit

ELI-49468r 96 Tests
EUR 886

ABCB8 siRNA

20-abx900065
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCB8 siRNA

20-abx906317
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCB8 siRNA

20-abx906318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCB8 Blocking Peptide

33R-2654 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCB8 antibody, catalog no. 70R-6464

ABCB8 cloning plasmid

CSB-CL868325HU1-10ug 10ug
EUR 713
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2157
  • Sequence: ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTC
  • Show more
Description: A cloning plasmid for the ABCB8 gene.

ABCB8 cloning plasmid

CSB-CL868325HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2082
  • Sequence: ATGCTGGTGCATTTATTTCGGGTCGGGATTCGGGGTGGCCCATTCCCAGGCAGGCTGCTACCGCCCCTCCGCTTCCAGACATTCTCAGCTGTCAGGTACTCTGATGGCTACCGCAGCTCCTCCCTCCTCCGGGCCGTGGCCCACCTGCGGTCCCAGCTCTGGGCCCACCTCCCTC
  • Show more
Description: A cloning plasmid for the ABCB8 gene.

ABCB8 Blocking Peptide

DF9249-BP 1mg
EUR 195

pCMV-SPORT6-ABCB8

PVT14439 2 ug
EUR 599

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human)

4-PAD638Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat)

4-PAD638Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), APC

4-PAD638Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), Biotinylated

4-PAD638Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), Cy3

4-PAD638Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), FITC

4-PAD638Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), HRP

4-PAD638Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), PE

4-PAD638Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat)

4-PAD638Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8)

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), APC

4-PAD638Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), Biotinylated

4-PAD638Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), Cy3

4-PAD638Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), FITC

4-PAD638Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), HRP

4-PAD638Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), PE

4-PAD638Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

Mouse ABCB8 shRNA Plasmid

20-abx978278
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ABCB8 shRNA Plasmid

20-abx990359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ABCB8 ELISA KIT

ELI-12201h 96 Tests
EUR 824

Mouse Abcb8 ELISA KIT

ELI-34983m 96 Tests
EUR 865

Human ABCB8 shRNA Plasmid

20-abx957672
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ABCB8 Recombinant Protein (Human)

RP036370 100 ug Ask for price

ABCB8 Recombinant Protein (Human)

RP036373 100 ug Ask for price

ABCB8 Recombinant Protein (Rat)

RP188549 100 ug Ask for price

ABCB8 Recombinant Protein (Mouse)

RP113324 100 ug Ask for price

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Human), APC-Cy7

4-PAD638Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Val472~Ser735)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), APC

4-PAD638Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), Biotinylated

4-PAD638Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), Cy3

4-PAD638Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), FITC

4-PAD638Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with FITC.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), HRP

4-PAD638Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with HRP.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), PE

4-PAD638Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with PE.

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Rat), APC-Cy7

4-PAD638Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Gln714)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx130565
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx130566
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx130567
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

abx038131-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx005962
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx321079
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx322557
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

abx432263-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx242244
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx242245
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter B8 (ABCB8) Antibody

20-abx225001
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Abcb8 ORF Vector (Mouse) (pORF)

ORF037776 1.0 ug DNA
EUR 506

ABCB8 ORF Vector (Human) (pORF)

ORF012124 1.0 ug DNA
EUR 354

ABCB8 ORF Vector (Human) (pORF)

ORF012125 1.0 ug DNA
EUR 354

Abcb8 ORF Vector (Rat) (pORF)

ORF062851 1.0 ug DNA
EUR 506

ATP Binding Cassette Transporter B8 (ABCB8) Polyclonal Antibody (Mouse, Rat), APC-Cy7

4-PAD638Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCB8 (Gly468~Ala717)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat ATP Binding Cassette Transporter B8 (ABCB8). This antibody is labeled with APC-Cy7.

ABCB8 sgRNA CRISPR Lentivector set (Human)

K0018501 3 x 1.0 ug
EUR 339

Abcb8 sgRNA CRISPR Lentivector set (Mouse)

K4691201 3 x 1.0 ug
EUR 339

Abcb8 sgRNA CRISPR Lentivector set (Rat)

K7379001 3 x 1.0 ug
EUR 339

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 1)

K0018502 1.0 ug DNA
EUR 154

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 2)

K0018503 1.0 ug DNA
EUR 154

ABCB8 sgRNA CRISPR Lentivector (Human) (Target 3)

K0018504 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4691202 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4691203 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4691204 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7379002 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7379003 1.0 ug DNA
EUR 154

Abcb8 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7379004 1.0 ug DNA
EUR 154

ABCB8 Protein Vector (Human) (pPB-C-His)

PV048493 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPB-N-His)

PV048494 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPM-C-HA)

PV048495 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPM-C-His)

PV048496 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPB-C-His)

PV048497 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPB-N-His)

PV048498 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPM-C-HA)

PV048499 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPM-C-His)

PV048500 500 ng
EUR 481

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)

4-RPD638Hu01
  • EUR 519.33
  • EUR 242.00
  • EUR 1672.48
  • EUR 624.16
  • EUR 1148.32
  • EUR 410.00
  • EUR 4031.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NUT2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human ATP Binding Cassette Transporter B8 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)

4-RPD638Mu01
  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9CXJ4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse ATP Binding Cassette Transporter B8 expressed in: E.coli

Recombinant ATP Binding Cassette Transporter B8 (ABCB8)

4-RPD638Ra01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5RKI8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat ATP Binding Cassette Transporter B8 expressed in: E.coli

ABCB8 Protein Vector (Human) (pPB-His-MBP)

PV318742 500 ng
EUR 481

ABCB8 Protein Vector (Human) (pPB-His-GST)

PV318743 500 ng
EUR 481

ABCB8 Protein Vector (Mouse) (pPB-C-His)

PV151102 500 ng
EUR 1065

ABCB8 Rabbit Polyclonal Antibody