ABCC9 Rabbit Polyclonal Antibody
ABCC9 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
ABCC9 Polyclonal Antibody |
ES9431-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ABCC9 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ABCC9 Polyclonal Antibody |
ES9431-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ABCC9 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
DLR-ABCC9-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter C9 (ABCC9) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
DLR-ABCC9-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATP Binding Cassette Transporter C9 (ABCC9) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
RD-ABCC9-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
RD-ABCC9-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
RDR-ABCC9-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human ATP Binding Cassette Transporter C9 (ABCC9) ELISA Kit |
RDR-ABCC9-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
ABCC9 Antibody |
40229-100ul |
SAB |
100ul |
EUR 252 |
ABCC9 Antibody |
1-CSB-PA001067LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
ABCC9 Antibody |
1-CSB-PA920347 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:40-1:150 |
ABCC9 Antibody |
DF9255 |
Affbiotech |
200ul |
EUR 304 |
Description: ABCC9 Antibody detects endogenous levels of total ABCC9. |
ABCC9 Antibody |
1-CSB-PA043862 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ABCC9 antibody |
70R-6250 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ABCC9 antibody |
Polyclonal ABCC9 / SUR2 Antibody (internal region) |
APG01426G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCC9 / SUR2 (internal region). This antibody is tested and proven to work in the following applications: |
ABCC9 Conjugated Antibody |
C40229 |
SAB |
100ul |
EUR 397 |
Anti-ABCC9 antibody |
STJ190589 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ABCC9 |
ABCC9 siRNA |
20-abx900073 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCC9 siRNA |
20-abx906339 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCC9 siRNA |
20-abx906340 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCC9 Antibody, HRP conjugated |
1-CSB-PA001067LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ABCC9 Antibody, FITC conjugated |
1-CSB-PA001067LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ABCC9 Antibody, Biotin conjugated |
1-CSB-PA001067LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCC9. Recognizes ABCC9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ABCC9 Blocking Peptide |
33R-1620 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCC9 antibody, catalog no. 70R-6250 |
ABCC9 Blocking Peptide |
DF9255-BP |
Affbiotech |
1mg |
EUR 195 |
ABCC9 cloning plasmid |
CSB-CL001067HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 450
- Sequence: atgagcctttcattttgtggtaacaacatttcttcatataatatcaacgatggtgtactacaaaattcctgctttgtggatgccctcaacctggtccctcatgtctttctgttgtttatcacttttccaatattgtttattgggtgggggagccaaagctcaaaagtacaaattca
- Show more
|
Description: A cloning plasmid for the ABCC9 gene. |
Mouse ABCC9 shRNA Plasmid |
20-abx972948 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat ABCC9 shRNA Plasmid |
20-abx985122 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ABCC9 shRNA Plasmid |
20-abx956776 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
20-abx214164 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
20-abx175497 |
Abbexa |
|
|
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
abx147871-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
20-abx171358 |
Abbexa |
|
|
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
abx030224-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
abx030224-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
20-abx241342 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
abx430474-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody |
20-abx302237 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Abcc9 ORF Vector (Rat) (pORF) |
ORF062862 |
ABM |
1.0 ug DNA |
EUR 2080 |
ABCC9 ORF Vector (Human) (pORF) |
ORF000030 |
ABM |
1.0 ug DNA |
EUR 95 |
Abcc9 ORF Vector (Mouse) (pORF) |
ORF037791 |
ABM |
1.0 ug DNA |
EUR 1572 |
Abcc9 ORF Vector (Mouse) (pORF) |
ORF037792 |
ABM |
1.0 ug DNA |
EUR 1572 |
Abcc9 ORF Vector (Mouse) (pORF) |
ORF037793 |
ABM |
1.0 ug DNA |
EUR 1572 |
Abcc9 ORF Vector (Mouse) (pORF) |
ORF037794 |
ABM |
1.0 ug DNA |
EUR 1572 |
ABCC9 ELISA Kit (Human) (OKCD01777) |
OKCD01777 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Subunit of ATP-sensitive potassium channels (KATP). Can form cardiac and smooth muscle-type KATP channels with KCNJ11. KCNJ11 forms the channel pore while ABCC9 is required for activation and regulation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.132 ng/mL |
ATP Binding Cassette Transporter C9 (ABCC9) Antibody (HRP) |
20-abx315562 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody (FITC) |
20-abx315563 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Transporter C9 (ABCC9) Antibody (Biotin) |
20-abx315564 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rabbit ATP- binding cassette sub- family C member 9, ABCC9 ELISA |
ELI-12229Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Abcc9 sgRNA CRISPR Lentivector set (Rat) |
K6900401 |
ABM |
3 x 1.0 ug |
EUR 339 |
ABCC9 sgRNA CRISPR Lentivector set (Human) |
K0019901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Abcc9 sgRNA CRISPR Lentivector set (Mouse) |
K3931201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit |
E04A1144-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit |
E04A1144-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP binding cassette sub family C member 9(ABCC9) ELISA kit |
E04A1144-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family C member 9(ABCC9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6900402 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6900403 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcc9 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6900404 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCC9 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0019902 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCC9 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0019903 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCC9 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0019904 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3931202 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3931203 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcc9 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3931204 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCC9 Protein Vector (Mouse) (pPB-C-His) |
PV151162 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPB-N-His) |
PV151163 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPM-C-HA) |
PV151164 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPM-C-His) |
PV151165 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPB-C-His) |
PV151166 |
ABM |
500 ng |
EUR 2555 |
ABCC9 Protein Vector (Mouse) (pPB-N-His) |
PV151167 |
ABM |
500 ng |
EUR 2555 |
ABCC9 Protein Vector (Mouse) (pPM-C-HA) |
PV151168 |
ABM |
500 ng |
EUR 2555 |
ABCC9 Protein Vector (Mouse) (pPM-C-His) |
PV151169 |
ABM |
500 ng |
EUR 2555 |
ABCC9 Protein Vector (Mouse) (pPB-C-His) |
PV151170 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPB-N-His) |
PV151171 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPM-C-HA) |
PV151172 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPM-C-His) |
PV151173 |
ABM |
500 ng |
EUR 2608 |
ABCC9 Protein Vector (Mouse) (pPB-C-His) |
PV151174 |
ABM |
500 ng |
EUR 2588 |
ABCC9 Protein Vector (Mouse) (pPB-N-His) |
PV151175 |
ABM |
500 ng |
EUR 2588 |
ABCC9 Protein Vector (Mouse) (pPM-C-HA) |
PV151176 |
ABM |
500 ng |
EUR 2588 |
ABCC9 Protein Vector (Mouse) (pPM-C-His) |
PV151177 |
ABM |
500 ng |
EUR 2588 |
ABCC9 Protein Vector (Rat) (pPB-C-His) |
PV251446 |
ABM |
500 ng |
EUR 2606 |
ABCC9 Protein Vector (Rat) (pPB-N-His) |
PV251447 |
ABM |
500 ng |
EUR 2606 |
ABCC9 Protein Vector (Rat) (pPM-C-HA) |
PV251448 |
ABM |
500 ng |
EUR 2606 |
ABCC9 Protein Vector (Rat) (pPM-C-His) |
PV251449 |
ABM |
500 ng |
EUR 2606 |
ABCC9 Protein Vector (Human) (pPB-His-MBP) |
PV318806 |
ABM |
500 ng |
EUR 329 |
ABCC9 Protein Vector (Human) (pPB-His-GST) |
PV318807 |
ABM |
500 ng |
EUR 329 |
ABCC9 Protein Vector (Human) (pPB-C-His) |
PV000117 |
ABM |
500 ng |
EUR 329 |
ABCC9 Protein Vector (Human) (pPB-N-His) |
PV000118 |
ABM |
500 ng |
EUR 329 |
ABCC9 Protein Vector (Human) (pPM-C-HA) |
PV000119 |
ABM |
500 ng |
EUR 329 |
ABCC9 Protein Vector (Human) (pPM-C-His) |
PV000120 |
ABM |
500 ng |
EUR 329 |
Abcc9 3'UTR Luciferase Stable Cell Line |
TU101163 |
ABM |
1.0 ml |
Ask for price |
Abcc9 3'UTR GFP Stable Cell Line |
TU151163 |
ABM |
1.0 ml |
Ask for price |
Abcc9 3'UTR Luciferase Stable Cell Line |
TU200066 |
ABM |
1.0 ml |
Ask for price |
Abcc9 3'UTR GFP Stable Cell Line |
TU250066 |
ABM |
1.0 ml |
Ask for price |
ABCC9 3'UTR GFP Stable Cell Line |
TU050070 |
ABM |
1.0 ml |
EUR 2333 |
ABCC9 3'UTR Luciferase Stable Cell Line |
TU000070 |
ABM |
1.0 ml |
EUR 2333 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
ABCC9 Rabbit Polyclonal Antibody