ABCD3 Rabbit Polyclonal Antibody

ABCD3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCD3 Polyclonal Antibody
30346-50ul 50ul
EUR 187
Polyclonal ABCD3 Antibody
APG01429G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ABCD3 . This antibody is tested and proven to work in the following applications:
ABCD3 Polyclonal Antibody
ABP57659-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCD3 from Human, Mouse, Rat. This ABCD3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
ABCD3 Polyclonal Antibody
ABP57659-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCD3 from Human, Mouse, Rat. This ABCD3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
ABCD3 Polyclonal Antibody
ABP57659-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of ABCD3 from Human, Mouse, Rat. This ABCD3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCD3 protein at amino acid sequence of 40-120
ABCD3 Polyclonal Antibody
ES9425-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCD3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ABCD3 Polyclonal Antibody
ES9425-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCD3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
ABCD3 Rabbit pAb
A18177-100ul 100 ul
EUR 308
ABCD3 Rabbit pAb
A18177-200ul 200 ul
EUR 459
ABCD3 Rabbit pAb
A18177-20ul 20 ul
EUR 183
ABCD3 Rabbit pAb
A18177-50ul 50 ul
EUR 223
ABCD3 Polyclonal Conjugated Antibody
C30346 100ul
EUR 397
ABCD3 Antibody
39411-100ul 100ul
EUR 390
ABCD3 Antibody
DF8315 200ul
EUR 304
Description: ABCD3 Antibody detects endogenous levels of total ABCD3.
ABCD3 antibody
70R-50298 100 ul
EUR 244
Description: Purified Polyclonal ABCD3 antibody
ABCD3 antibody
70R-7348 50 ug
EUR 467
Description: Rabbit polyclonal ABCD3 antibody
ABCD3 Antibody
ABD8315 100 ug
EUR 438
Polyclonal Goat Anti-ABCD3 Antibody
AMM04856G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ABCD3 . This antibody is tested and proven to work in the following applications:
ABCD3 Antibody (Biotin)
abx431542-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Anti-ABCD3 antibody
STJ11100138 100 µl
EUR 277
Anti-ABCD3 antibody
STJ71633 100 µg
EUR 359
Anti-ABCD3 antibody
STJ190583 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCD3
Abcd3/ Rat Abcd3 ELISA Kit
ELI-12150r 96 Tests
EUR 886
ABCD3 siRNA
20-abx900075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ABCD3 siRNA
20-abx906345
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ABCD3 siRNA
20-abx906346
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pENTR223- ABCD3
PVT11491 2 ug
EUR 273
Anti-PMP70/ABCD3 Antibody
PA2091 100ug/vial
EUR 334
Anti-ABCD3, Biotinylated antibody
STJ73239 100 µg
EUR 359
ABCD3 Blocking Peptide
33R-5113 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCD3 antibody, catalog no. 70R-7348
ABCD3 Blocking Peptide
DF8315-BP 1mg
EUR 195
ABCD3 Blocking Peptide
20-abx063173
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
ABCD3 cloning plasmid
CSB-CL001074HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtggt
  • Show more
Description: A cloning plasmid for the ABCD3 gene.
ABCD3 cloning plasmid
CSB-CL001074HU2-10ug 10ug
EUR 572
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1650
  • Sequence: atggcggccttcagcaagtacttgacggcgcgaaactcctcgctggctggtgccgcgttcctgctgctctgcctgctccacaagcggcgccgcgccctcggcctgcacggtaagaaaagtggaaaaccaccattacagaacaatgagaaagaggggaaaaaggagcgagctgtgg
  • Show more
Description: A cloning plasmid for the ABCD3 gene.
Human ABCD3 ELISA KIT
ELI-12149h 96 Tests
EUR 824
Mouse ABCD3 shRNA Plasmid
20-abx972325
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat ABCD3 shRNA Plasmid
20-abx984885
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human ABCD3 shRNA Plasmid
20-abx953937
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Abcd3 ELISA KIT
ELI-49832m 96 Tests
EUR 865
pECMV-3-FLAG-ABCD3
PVT13327 2 ug
EUR 599
ABCD3 Recombinant Protein (Human)
RP000091 100 ug Ask for price
ABCD3 Recombinant Protein (Human)
RP000094 100 ug Ask for price
ABCD3 Recombinant Protein (Mouse)
RP113387 100 ug Ask for price
ABCD3 Recombinant Protein (Rat)
RP188591 100 ug Ask for price
Abcd3 ORF Vector (Rat) (pORF)
ORF062865 1.0 ug DNA
EUR 506
ABCD3 ORF Vector (Human) (pORF)
ORF000031 1.0 ug DNA
EUR 95
ABCD3 ORF Vector (Human) (pORF)
ORF000032 1.0 ug DNA
EUR 95
Abcd3 ORF Vector (Mouse) (pORF)
ORF037797 1.0 ug DNA
EUR 506
Abcd3 sgRNA CRISPR Lentivector set (Rat)
K6886301 3 x 1.0 ug
EUR 339
Abcd3 sgRNA CRISPR Lentivector set (Mouse)
K4565901 3 x 1.0 ug
EUR 339
ABCD3 sgRNA CRISPR Lentivector set (Human)
K0021001 3 x 1.0 ug
EUR 339
Rabbit ATP binding cassette sub family D member 3(ABCD3) ELISA kit
E04A1147-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family D member 3(ABCD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit ATP binding cassette sub family D member 3(ABCD3) ELISA kit
E04A1147-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family D member 3(ABCD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit ATP binding cassette sub family D member 3(ABCD3) ELISA kit
E04A1147-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family D member 3(ABCD3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Abcd3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6886302 1.0 ug DNA
EUR 154
Abcd3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6886303 1.0 ug DNA
EUR 154
Abcd3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6886304 1.0 ug DNA
EUR 154
Abcd3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4565902 1.0 ug DNA
EUR 154
Abcd3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4565903 1.0 ug DNA
EUR 154
Abcd3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4565904 1.0 ug DNA
EUR 154
ABCD3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0021002 1.0 ug DNA
EUR 154
ABCD3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0021003 1.0 ug DNA
EUR 154
ABCD3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0021004 1.0 ug DNA
EUR 154
ABCD3 Protein Vector (Mouse) (pPB-C-His)
PV151186 500 ng
EUR 603
ABCD3 Protein Vector (Mouse) (pPB-N-His)
PV151187 500 ng
EUR 603
ABCD3 Protein Vector (Mouse) (pPM-C-HA)
PV151188 500 ng
EUR 603
ABCD3 Protein Vector (Mouse) (pPM-C-His)
PV151189 500 ng
EUR 603
ABCD3 Protein Vector (Rat) (pPB-C-His)
PV251458 500 ng
EUR 603
ABCD3 Protein Vector (Rat) (pPB-N-His)
PV251459 500 ng
EUR 603
ABCD3 Protein Vector (Rat) (pPM-C-HA)
PV251460 500 ng
EUR 603
ABCD3 Protein Vector (Rat) (pPM-C-His)
PV251461 500 ng
EUR 603
ABCD3 Protein Vector (Human) (pPB-His-MBP)
PV318838 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-His-GST)
PV318839 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-His-MBP)
PV318842 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-His-GST)
PV318843 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-C-His)
PV000121 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-N-His)
PV000122 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPM-C-HA)
PV000123 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPM-C-His)
PV000124 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-C-His)
PV000125 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPB-N-His)
PV000126 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPM-C-HA)
PV000127 500 ng
EUR 329
ABCD3 Protein Vector (Human) (pPM-C-His)
PV000128 500 ng
EUR 329
Abcd3 3'UTR Luciferase Stable Cell Line
TU101166 1.0 ml Ask for price
Abcd3 3'UTR GFP Stable Cell Line
TU151166 1.0 ml Ask for price
Abcd3 3'UTR Luciferase Stable Cell Line
TU200069 1.0 ml Ask for price
Abcd3 3'UTR GFP Stable Cell Line
TU250069 1.0 ml Ask for price
ABCD3 3'UTR GFP Stable Cell Line
TU050081 1.0 ml
EUR 1521
ABCD3 3'UTR Luciferase Stable Cell Line
TU000081 1.0 ml
EUR 1521
ATP-Binding Cassette Sub-Family D Member 3 (ABCD3) Antibody
20-abx008794
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
ATP-Binding Cassette Sub-Family D Member 3 (ABCD3) Antibody
abx038197-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
ATP-Binding Cassette Sub-Family D Member 3 (ABCD3) Antibody
abx431541-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

ABCD3 Rabbit Polyclonal Antibody