ABCF3 Rabbit Polyclonal Antibody
ABCF3 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
ABCF3 Polyclonal Antibody |
ABP57660-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120 |
ABCF3 Polyclonal Antibody |
ABP57660-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of ABCF3 from Human, Mouse, Rat. This ABCF3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ABCF3 protein at amino acid sequence of 40-120 |
ABCF3 Polyclonal Antibody |
ES9426-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ABCF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ABCF3 Polyclonal Antibody |
ES9426-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ABCF3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ABCF3 Rabbit pAb |
A15168-100ul |
Abclonal |
100 ul |
EUR 308 |
ABCF3 Rabbit pAb |
A15168-200ul |
Abclonal |
200 ul |
EUR 459 |
ABCF3 Rabbit pAb |
A15168-20ul |
Abclonal |
20 ul |
EUR 183 |
ABCF3 Rabbit pAb |
A15168-50ul |
Abclonal |
50 ul |
EUR 223 |
ABCF3 Antibody |
36005-100ul |
SAB |
100ul |
EUR 252 |
ABCF3 Antibody |
1-CSB-PA595084 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ABCF3 Antibody |
1-CSB-PA889115LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ABCF3 Antibody |
1-CSB-PA781903 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ABCF3 Antibody |
DF9251 |
Affbiotech |
200ul |
EUR 304 |
Description: ABCF3 Antibody detects endogenous levels of total ABCF3. |
ABCF3 antibody |
70R-51386 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal ABCF3 antibody |
ABCF3 antibody |
70R-6278 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ABCF3 antibody |
Polyclonal ABCF3 Antibody (internal region) |
APG00557G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCF3 (internal region). This antibody is tested and proven to work in the following applications: |
ABCF3 Polyclonal Antibody, Biotin Conjugated |
A57935 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
ABCF3 Polyclonal Antibody, FITC Conjugated |
A57936 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
ABCF3 Polyclonal Antibody, HRP Conjugated |
A57937 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
ABCF3 Conjugated Antibody |
C36005 |
SAB |
100ul |
EUR 397 |
Anti-ABCF3 antibody |
STJ117362 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding cassette proteins transport various molecules across extra- and intracellular membranes. The protein encoded by this gene displays antiviral effect against flaviviruses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-ABCF3 antibody |
STJ190584 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ABCF3 |
ABCF3 siRNA |
20-abx900077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCF3 siRNA |
20-abx906355 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCF3 siRNA |
20-abx906356 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ABCF3 |
YF-PA19690 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ABCF3 |
ABCF3 Antibody, HRP conjugated |
1-CSB-PA889115LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ABCF3 Antibody, FITC conjugated |
1-CSB-PA889115LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ABCF3 Antibody, Biotin conjugated |
1-CSB-PA889115LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ABCF3. Recognizes ABCF3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ABCF3 Blocking Peptide |
33R-1883 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ABCF3 antibody, catalog no. 70R-6278 |
ABCF3 Blocking Peptide |
DF9251-BP |
Affbiotech |
1mg |
EUR 195 |
ABCF3 Blocking Peptide |
20-abx064261 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ABCF3 cloning plasmid |
CSB-CL889115HU1-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2130
- Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
- Show more
|
Description: A cloning plasmid for the ABCF3 gene. |
ABCF3 cloning plasmid |
CSB-CL889115HU2-10ug |
Cusabio |
10ug |
EUR 706 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2130
- Sequence: atggcgacttgcgccgaaatcctgcggagcgagttccccgaaattgacggacaagtcttcgactacgtgaccggcgtcttgcacagcggcagcgcggacttcgagtctgtggatgacctggtggaagctgtaggggaactattgcaagaggtgtccggggacagcaaggatgacg
- Show more
|
Description: A cloning plasmid for the ABCF3 gene. |
Rat ABCF3 shRNA Plasmid |
20-abx988292 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ABCF3 shRNA Plasmid |
20-abx973908 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ABCF3 shRNA Plasmid |
20-abx960655 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ABCF3 Recombinant Protein (Human) |
RP000106 |
ABM |
100 ug |
Ask for price |
ABCF3 Recombinant Protein (Human) |
RP000109 |
ABM |
100 ug |
Ask for price |
ABCF3 Recombinant Protein (Mouse) |
RP113405 |
ABM |
100 ug |
Ask for price |
ABCF3 Recombinant Protein (Rat) |
RP188606 |
ABM |
100 ug |
Ask for price |
Abcf3 ORF Vector (Rat) (pORF) |
ORF062870 |
ABM |
1.0 ug DNA |
EUR 506 |
ABCF3 ORF Vector (Human) (pORF) |
ORF000036 |
ABM |
1.0 ug DNA |
EUR 95 |
ABCF3 ORF Vector (Human) (pORF) |
ORF000037 |
ABM |
1.0 ug DNA |
EUR 95 |
Abcf3 ORF Vector (Mouse) (pORF) |
ORF037803 |
ABM |
1.0 ug DNA |
EUR 506 |
Abcf3 sgRNA CRISPR Lentivector set (Rat) |
K6246001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Abcf3 sgRNA CRISPR Lentivector set (Mouse) |
K3532401 |
ABM |
3 x 1.0 ug |
EUR 339 |
ABCF3 sgRNA CRISPR Lentivector set (Human) |
K0021501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit |
E04A1152-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit |
E04A1152-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP binding cassette sub family F member 3(ABCF3) ELISA kit |
E04A1152-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family F member 3(ABCF3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
20-abx007772 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
abx038087-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
abx038088-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
20-abx241169 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
20-abx241170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
abx431873-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody |
20-abx301739 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6246002 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6246003 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcf3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6246004 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3532402 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3532403 |
ABM |
1.0 ug DNA |
EUR 154 |
Abcf3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3532404 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCF3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0021502 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCF3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0021503 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCF3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0021504 |
ABM |
1.0 ug DNA |
EUR 154 |
ABCF3 Protein Vector (Mouse) (pPB-C-His) |
PV151210 |
ABM |
500 ng |
EUR 1065 |
ABCF3 Protein Vector (Mouse) (pPB-N-His) |
PV151211 |
ABM |
500 ng |
EUR 1065 |
ABCF3 Protein Vector (Mouse) (pPM-C-HA) |
PV151212 |
ABM |
500 ng |
EUR 1065 |
ABCF3 Protein Vector (Mouse) (pPM-C-His) |
PV151213 |
ABM |
500 ng |
EUR 1065 |
ABCF3 Protein Vector (Rat) (pPB-C-His) |
PV251478 |
ABM |
500 ng |
EUR 1166 |
ABCF3 Protein Vector (Rat) (pPB-N-His) |
PV251479 |
ABM |
500 ng |
EUR 1166 |
ABCF3 Protein Vector (Rat) (pPM-C-HA) |
PV251480 |
ABM |
500 ng |
EUR 1166 |
ABCF3 Protein Vector (Rat) (pPM-C-His) |
PV251481 |
ABM |
500 ng |
EUR 1166 |
ABCF3 Protein Vector (Human) (pPB-His-MBP) |
PV318862 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-His-GST) |
PV318863 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-His-MBP) |
PV318866 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-His-GST) |
PV318867 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-C-His) |
PV000141 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-N-His) |
PV000142 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPM-C-HA) |
PV000143 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPM-C-His) |
PV000144 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-C-His) |
PV000145 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPB-N-His) |
PV000146 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPM-C-HA) |
PV000147 |
ABM |
500 ng |
EUR 329 |
ABCF3 Protein Vector (Human) (pPM-C-His) |
PV000148 |
ABM |
500 ng |
EUR 329 |
Abcf3 3'UTR Luciferase Stable Cell Line |
TU101171 |
ABM |
1.0 ml |
Ask for price |
Abcf3 3'UTR GFP Stable Cell Line |
TU151171 |
ABM |
1.0 ml |
Ask for price |
Abcf3 3'UTR Luciferase Stable Cell Line |
TU200074 |
ABM |
1.0 ml |
Ask for price |
Abcf3 3'UTR GFP Stable Cell Line |
TU250074 |
ABM |
1.0 ml |
Ask for price |
ABCF3 3'UTR GFP Stable Cell Line |
TU050086 |
ABM |
1.0 ml |
EUR 1394 |
ABCF3 3'UTR Luciferase Stable Cell Line |
TU000086 |
ABM |
1.0 ml |
EUR 1394 |
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (HRP) |
20-abx312080 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (FITC) |
20-abx312081 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP Binding Cassette Subfamily F Member 3 (ABCF3) Antibody (Biotin) |
20-abx312082 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ABCF3 Rabbit Polyclonal Antibody