ABCG4 Rabbit Polyclonal Antibody

ABCG4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ABCG4 Polyclonal Antibody

ES9427-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ABCG4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCG4 Polyclonal Antibody

ES9427-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ABCG4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ABCG4 Rabbit pAb

A14596-100ul 100 ul
EUR 308

ABCG4 Rabbit pAb

A14596-200ul 200 ul
EUR 459

ABCG4 Rabbit pAb

A14596-20ul 20 ul
EUR 183

ABCG4 Rabbit pAb

A14596-50ul 50 ul
EUR 223

ABCG4 antibody

70R-15511 50 ul
EUR 435
Description: Rabbit polyclonal ABCG4 antibody

ABCG4 Antibody

36006-100ul 100ul
EUR 252

ABCG4 Antibody

1-CSB-PA001082GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ABCG4. Recognizes ABCG4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ABCG4 Antibody

DF9252 200ul
EUR 304
Description: ABCG4 Antibody detects endogenous levels of total ABCG4.

ABCG4 Antibody

1-CSB-PA040368
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ABCG4. Recognizes ABCG4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

ABCG4 Antibody

ABD9252 100 ug
EUR 438

Polyclonal ABCG4 Antibody (C-Term)

APG01456G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ABCG4 (C-Term). This antibody is tested and proven to work in the following applications:

ABCG4 Conjugated Antibody

C36006 100ul
EUR 397

anti- ABCG4 antibody

FNab00043 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ATP-binding cassette, sub-family G(WHITE), member 4
  • Uniprot ID: Q9H172
  • Gene ID: 64137
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against ABCG4

Anti-ABCG4 Antibody

PA2067 100ug/vial
EUR 294

Anti-ABCG4 antibody

PAab00043 100 ug
EUR 355

Anti-ABCG4 antibody

STJ116806 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein is a member of the White subfamily and plays an important role in cellular cholesterol homeostasis. This protein functions as either a homodimer or as a heterodimer with another ABC subfamily protein such as ABCG1.

Anti-ABCG4 antibody

STJ71647 100 µg
EUR 260

Anti-ABCG4 antibody

STJ190585 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ABCG4

ABCG4 siRNA

20-abx906362
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ABCG4 Blocking Peptide

DF9252-BP 1mg
EUR 195

ABCG4 cloning plasmid

CSB-CL887952HU-10ug 10ug
EUR 653
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1941
  • Sequence: atggcggagaaggcgctggaggccgtgggctgtggactagggccgggggctgtggccatggccgtgacgctggaggacggggcggaaccccctgtgctgaccacgcacctgaagaaggtggagaaccacatcactgaagcccagcgcttctcccacctacccaagcgctcagccg
  • Show more
Description: A cloning plasmid for the ABCG4 gene.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human)

4-PAD657Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4)

Human ABCG4 ELISA KIT

ELI-24637h 96 Tests
EUR 824

ABCG4 ELISA KIT|Human

EF007534 96 Tests
EUR 689

Human ABCG4 shRNA Plasmid

20-abx961941
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-ABCG4 Plasmid

PVT16746 2 ug
EUR 325

ABCG4 Recombinant Protein (Human)

RP000112 100 ug Ask for price

ABCG4 Recombinant Protein (Mouse)

RP113417 100 ug Ask for price

ABCG4 Recombinant Protein (Rat)

RP188630 100 ug Ask for price

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), APC

4-PAD657Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with APC.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), Biotinylated

4-PAD657Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with Biotin.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), Cy3

4-PAD657Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with Cy3.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), FITC

4-PAD657Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with FITC.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), HRP

4-PAD657Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with HRP.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), PE

4-PAD657Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with PE.

ATP Binding Cassette Transporter G4 (ABCG4) Polyclonal Antibody (Human), APC-Cy7

4-PAD657Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ABCG4 (Val59~Thr301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human ATP Binding Cassette Transporter G4 (ABCG4). This antibody is labeled with APC-Cy7.

ATP Binding Cassette Transporter G4 (ABCG4) Antibody

20-abx213415
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Transporter G4 (ABCG4) Antibody

20-abx130583
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Abcg4 ORF Vector (Rat) (pORF)

ORF062878 1.0 ug DNA
EUR 506

ABCG4 ORF Vector (Human) (pORF)

ORF000038 1.0 ug DNA
EUR 95

Abcg4 ORF Vector (Mouse) (pORF)

ORF037807 1.0 ug DNA
EUR 506

Abcg4 sgRNA CRISPR Lentivector set (Rat)

K6577901 3 x 1.0 ug
EUR 339

Abcg4 sgRNA CRISPR Lentivector set (Mouse)

K3316101 3 x 1.0 ug
EUR 339

ABCG4 sgRNA CRISPR Lentivector set (Human)

K0021801 3 x 1.0 ug
EUR 339

Rabbit ATP binding cassette sub family G member 4(ABCG4) ELISA kit

E04A1153-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family G member 4(ABCG4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family G member 4(ABCG4) ELISA kit

E04A1153-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family G member 4(ABCG4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP binding cassette sub family G member 4(ABCG4) ELISA kit

E04A1153-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP binding cassette sub family G member 4(ABCG4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP Binding Cassette Subfamily G Member 4 (ABCG4) Antibody

abx026975-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily G Member 4 (ABCG4) Antibody

abx026975-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily G Member 4 (ABCG4) Antibody

20-abx111171
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ATP Binding Cassette Subfamily G Member 4 (ABCG4) Antibody

abx431539-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ATP Binding Cassette Subfamily G Member 4 (ABCG4) Antibody

abx230043-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Abcg4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6577902 1.0 ug DNA
EUR 154

Abcg4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6577903 1.0 ug DNA
EUR 154

Abcg4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6577904 1.0 ug DNA
EUR 154

Abcg4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3316102 1.0 ug DNA
EUR 154

Abcg4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3316103 1.0 ug DNA
EUR 154

Abcg4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3316104 1.0 ug DNA
EUR 154

ABCG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0021802 1.0 ug DNA
EUR 154

ABCG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0021803 1.0 ug DNA
EUR 154

ABCG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0021804 1.0 ug DNA
EUR 154

ABCG4 Protein Vector (Mouse) (pPB-C-His)

PV151226 500 ng
EUR 603

ABCG4 Protein Vector (Mouse) (pPB-N-His)

PV151227 500 ng
EUR 603

ABCG4 Protein Vector (Mouse) (pPM-C-HA)

PV151228 500 ng
EUR 603

ABCG4 Protein Vector (Mouse) (pPM-C-His)

PV151229 500 ng
EUR 603

ABCG4 Protein Vector (Rat) (pPB-C-His)

PV251510 500 ng
EUR 603

ABCG4 Protein Vector (Rat) (pPB-N-His)

PV251511 500 ng
EUR 603

ABCG4 Protein Vector (Rat) (pPM-C-HA)

PV251512 500 ng
EUR 603

ABCG4 Protein Vector (Rat) (pPM-C-His)

PV251513 500 ng
EUR 603

ABCG4 Protein Vector (Human) (pPB-His-MBP)

PV318878 500 ng
EUR 329

ABCG4 Protein Vector (Human) (pPB-His-GST)

PV318879 500 ng
EUR 329

ABCG4 Protein Vector (Human) (pPB-C-His)

PV000149 500 ng
EUR 329

ABCG4 Protein Vector (Human) (pPB-N-His)

PV000150 500 ng
EUR 329

ABCG4 Protein Vector (Human) (pPM-C-HA)

PV000151 500 ng
EUR 329

ABCG4 Protein Vector (Human) (pPM-C-His)

PV000152 500 ng
EUR 329

Recombinant ATP Binding Cassette Transporter G4 (ABCG4)

4-RPD657Hu01
  • EUR 429.73
  • EUR 218.00
  • EUR 1336.48
  • EUR 512.16
  • EUR 924.32
  • EUR 350.00
  • EUR 3191.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H172
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human ATP Binding Cassette Transporter G4 expressed in: E.coli

Abcg4 3'UTR Luciferase Stable Cell Line

TU101175 1.0 ml Ask for price

Abcg4 3'UTR GFP Stable Cell Line

TU151175 1.0 ml Ask for price

Abcg4 3'UTR Luciferase Stable Cell Line

TU200082 1.0 ml Ask for price

Abcg4 3'UTR GFP Stable Cell Line

TU250082 1.0 ml Ask for price

ABCG4 3'UTR GFP Stable Cell Line

TU050089 1.0 ml
EUR 1521

ABCG4 3'UTR Luciferase Stable Cell Line

TU000089 1.0 ml
EUR 1521

Human ATP Binding Cassette Transporter G4 (ABCG4) Protein

20-abx650409
  • EUR 606.00
  • EUR 258.00
  • EUR 1803.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

ABCG4 Rabbit Polyclonal Antibody