AFF4 Rabbit Polyclonal Antibody

AFF4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

AFF4 Polyclonal Antibody

ES9367-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AFF4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AFF4 Polyclonal Antibody

ES9367-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AFF4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AFF4 Rabbit pAb

A4644-100ul 100 ul
EUR 308

AFF4 Rabbit pAb

A4644-200ul 200 ul
EUR 459

AFF4 Rabbit pAb

A4644-20ul 20 ul
EUR 183

AFF4 Rabbit pAb

A4644-50ul 50 ul
EUR 223

AFF4 antibody

70R-15618 50 ul
EUR 435
Description: Rabbit polyclonal AFF4 antibody

AFF4 Antibody

45755-100ul 100ul
EUR 252

AFF4 Antibody

45755-50ul 50ul
EUR 187

AFF4 Antibody

1-CSB-PA001415GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA

AFF4 Antibody

1-CSB-PA890687LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:2000-1:5000

AFF4 Antibody

DF9180 200ul
EUR 304
Description: AFF4 Antibody detects endogenous levels of total AFF4.

AFF4 Antibody

ABD9180 100 ug
EUR 438

Anti-AFF4 Antibody

A03824 100ug/vial
EUR 334

AFF4 Conjugated Antibody

C45755 100ul
EUR 397

anti- AFF4 antibody

FNab00196 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: AF4/FMR2 family, member 4
  • Uniprot ID: Q9UHB7
  • Gene ID: 27125
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFF4

anti- AFF4 antibody

FNab00197 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • Immunogen: AF4/FMR2 family, member 4
  • Uniprot ID: Q9UHB7
  • Gene ID: 27125
  • Research Area: Cancer, Metabolism
Description: Antibody raised against AFF4

Anti-AFF4 antibody

PAab00196 100 ug
EUR 355

Anti-AFF4 antibody

PAab00197 100 ug
EUR 355

Anti-AFF4 antibody

STJ22540 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23).

Anti-AFF4 antibody

STJ190525 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AFF4

AFF4 siRNA

20-abx906952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AFF4 siRNA

20-abx906953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-AFF4

YF-PA18383 50 ug
EUR 363
Description: Mouse polyclonal to AFF4

anti-AFF4

YF-PA18384 100 ug
EUR 403
Description: Rabbit polyclonal to AFF4

anti-AFF4

YF-PA26038 50 ul
EUR 334
Description: Mouse polyclonal to AFF4

AFF4 Antibody, HRP conjugated

1-CSB-PA890687LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AFF4 Antibody, FITC conjugated

1-CSB-PA890687LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AFF4 Antibody, Biotin conjugated

1-CSB-PA890687LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AFF4 Blocking Peptide

DF9180-BP 1mg
EUR 195

AFF4 cloning plasmid

CSB-CL890687HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
  • Show more
Description: A cloning plasmid for the AFF4 gene.

AFF4 cloning plasmid

CSB-CL890687HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1062
  • Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
  • Show more
Description: A cloning plasmid for the AFF4 gene.

pDONR223-AFF4 Plasmid

PVTB00802 2 ug
EUR 356

pENTR223-AFF4 vector

PVT12009 2 ug
EUR 308

Anti-AFF4 (2E12)

YF-MA11449 100 ug
EUR 363
Description: Mouse monoclonal to AFF4

AFF4 ELISA KIT|Human

EF007649 96 Tests
EUR 689

Human AFF4 shRNA Plasmid

20-abx958979
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AFF4 shRNA Plasmid

20-abx979227
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit

E04A1303-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx003497
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx110898
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx148042
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

20-abx317951
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

abx230196-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

AF4/FMR2 Family Member 4 (AFF4) Antibody

abx230197-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Aff4 ORF Vector (Rat) (pORF)

ORF063158 1.0 ug DNA
EUR 506

AFF4 ORF Vector (Human) (pORF)

ORF000229 1.0 ug DNA
EUR 95

AFF4 Rabbit Polyclonal Antibody