AFF4 Rabbit Polyclonal Antibody
AFF4 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
AFF4 Polyclonal Antibody |
ES9367-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AFF4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AFF4 Polyclonal Antibody |
ES9367-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AFF4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AFF4 Rabbit pAb |
A4644-100ul |
Abclonal |
100 ul |
EUR 308 |
AFF4 Rabbit pAb |
A4644-200ul |
Abclonal |
200 ul |
EUR 459 |
AFF4 Rabbit pAb |
A4644-20ul |
Abclonal |
20 ul |
EUR 183 |
AFF4 Rabbit pAb |
A4644-50ul |
Abclonal |
50 ul |
EUR 223 |
AFF4 antibody |
70R-15618 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AFF4 antibody |
AFF4 Antibody |
45755-100ul |
SAB |
100ul |
EUR 252 |
AFF4 Antibody |
45755-50ul |
SAB |
50ul |
EUR 187 |
AFF4 Antibody |
1-CSB-PA001415GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA |
AFF4 Antibody |
1-CSB-PA890687LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:2000-1:5000 |
AFF4 Antibody |
DF9180 |
Affbiotech |
200ul |
EUR 304 |
Description: AFF4 Antibody detects endogenous levels of total AFF4. |
Anti-AFF4 Antibody |
A03824 |
BosterBio |
100ug/vial |
EUR 334 |
AFF4 Conjugated Antibody |
C45755 |
SAB |
100ul |
EUR 397 |
anti- AFF4 antibody |
FNab00196 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- Immunogen: AF4/FMR2 family, member 4
- Uniprot ID: Q9UHB7
- Gene ID: 27125
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against AFF4 |
anti- AFF4 antibody |
FNab00197 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- Immunogen: AF4/FMR2 family, member 4
- Uniprot ID: Q9UHB7
- Gene ID: 27125
- Research Area: Cancer, Metabolism
|
Description: Antibody raised against AFF4 |
Anti-AFF4 antibody |
STJ22540 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). |
Anti-AFF4 antibody |
STJ190525 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AFF4 |
AFF4 siRNA |
20-abx906952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AFF4 siRNA |
20-abx906953 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-AFF4 |
YF-PA18383 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to AFF4 |
anti-AFF4 |
YF-PA18384 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to AFF4 |
anti-AFF4 |
YF-PA26038 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to AFF4 |
AFF4 Antibody, HRP conjugated |
1-CSB-PA890687LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AFF4 Antibody, FITC conjugated |
1-CSB-PA890687LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AFF4 Antibody, Biotin conjugated |
1-CSB-PA890687LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AFF4. Recognizes AFF4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
AFF4 Blocking Peptide |
DF9180-BP |
Affbiotech |
1mg |
EUR 195 |
AFF4 cloning plasmid |
CSB-CL890687HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1098
- Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
- Show more
|
Description: A cloning plasmid for the AFF4 gene. |
AFF4 cloning plasmid |
CSB-CL890687HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1062
- Sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaact
- Show more
|
Description: A cloning plasmid for the AFF4 gene. |
Anti-AFF4 (2E12) |
YF-MA11449 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to AFF4 |
Human AFF4 shRNA Plasmid |
20-abx958979 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AFF4 shRNA Plasmid |
20-abx979227 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
E04A1303-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
E04A1303-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AF4/FMR2 family member 4(AFF4) ELISA kit |
E04A1303-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AF4/FMR2 family member 4(AFF4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
AF4/FMR2 Family Member 4 (AFF4) Antibody |
20-abx003497 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
20-abx110898 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
20-abx148042 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
20-abx317951 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
abx230196-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
AF4/FMR2 Family Member 4 (AFF4) Antibody |
abx230197-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Aff4 ORF Vector (Rat) (pORF) |
ORF063158 |
ABM |
1.0 ug DNA |
EUR 506 |
AFF4 ORF Vector (Human) (pORF) |
ORF000229 |
ABM |
1.0 ug DNA |
EUR 95 |
AFF4 Rabbit Polyclonal Antibody