ALS2 Rabbit Polyclonal Antibody

ALS2 Rabbit Polyclonal Antibody

Order Now:

ALS2 Polyclonal Antibody

ABP57749-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470

ALS2 Polyclonal Antibody

ABP57749-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470

ALS2 Polyclonal Antibody

ABP57749-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470

ALS2 Rabbit pAb

A7125-100ul 100 ul
EUR 308

ALS2 Rabbit pAb

A7125-200ul 200 ul
EUR 459

ALS2 Rabbit pAb

A7125-20ul 20 ul
EUR 183

ALS2 Rabbit pAb

A7125-50ul 50 ul
EUR 223

ALS2 Rabbit pAb

A4895-100ul 100 ul
EUR 308

ALS2 Rabbit pAb

A4895-200ul 200 ul
EUR 459

ALS2 Rabbit pAb

A4895-20ul 20 ul
EUR 183

ALS2 Rabbit pAb

A4895-50ul 50 ul
EUR 223

ALS2 Antibody

ABD9196 100 ug
EUR 438

ALS2 antibody

70R-3555 50 ug
EUR 467
Description: Rabbit polyclonal ALS2 antibody

ALS2 Antibody

36087-100ul 100ul
EUR 252

ALS2 antibody

70R-15692 50 ul
EUR 435
Description: Rabbit polyclonal ALS2 antibody

ALS2 Antibody

DF9196 200ul
EUR 304
Description: ALS2 Antibody detects endogenous levels of total ALS2.

ALS2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ALS2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ALS2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal ALS2 / Alsin Antibody (C-Terminus)

APR11387G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ALS2 / Alsin (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-Alsin / ALS2 Antibody

APR12066G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Alsin / ALS2 . This antibody is tested and proven to work in the following applications:

Rabbit Alsin(ALS2) ELISA kit

E04A1408-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alsin(ALS2) ELISA kit

E04A1408-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alsin(ALS2) ELISA kit

E04A1408-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ALS2 Conjugated Antibody

C36087 100ul
EUR 397

anti- ALS2 antibody

FNab00350 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: amyotrophic lateral sclerosis 2(juvenile)
  • Uniprot ID: Q96Q42
  • Gene ID: 57679
  • Research Area: Neuroscience, Cell Division and Proliferation, Signal Tran
  • Show more
Description: Antibody raised against ALS2

Alsin (ALS2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

abx036694-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

abx032830-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

abx032830-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

abx430481-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Alsin (ALS2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Alsin (ALS2) Antibody

abx230350-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-ALS2 antibody

PAab00350 100 ug
EUR 355

Anti-ALS2 antibody

STJ29205 100 µl
EUR 277
Description: The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ALS2 antibody

STJ116266 100 µl
EUR 277
Description: The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ALS2 antibody

STJ190540 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ALS2

Als2/ Rat Als2 ELISA Kit

ELI-49243r 96 Tests
EUR 886


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


GT41001 100 ug
EUR 455


P41001 100 ug Blocking Peptide
EUR 239


YF-PA20253 50 ul
EUR 363
Description: Mouse polyclonal to Als2


YF-PA20254 100 ug
EUR 403
Description: Rabbit polyclonal to Als2


YF-PA27601 50 ug
EUR 363
Description: Mouse polyclonal to ALS2

Anti-Alsin / ALS2 antibody

STJ70122 100 µg
EUR 359

ALS2 Blocking Peptide

33R-1366 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSKS antibody, catalog no. 70R-3083

ALS2 cloning plasmid

CSB-CL857009HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2439
  • Sequence: atggactcaaagaagagaagctcaacagaggcagaaggatccaaggaaagaggcctggtccatatctggcaggcaggatcctttcccataacaccagagagattgccaggctggggaggaaagactgttttgcaggcagccctcggagtgaaacatggagttcttctgactgaag
  • Show more
Description: A cloning plasmid for the ALS2 gene.

ALS2 Blocking Peptide

DF9196-BP 1mg
EUR 195

Anti-Als2 (4F9)

YF-MA19088 100 ug
EUR 363
Description: Mouse monoclonal to Als2

Anti-Als2 (4F10)

YF-MA19089 100 ug
EUR 363
Description: Mouse monoclonal to Als2

Mouse ALS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ALS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF007736 96 Tests
EUR 689

Human ALS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-ALS2 Plasmid

PVT16488 2 ug
EUR 325

Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit

E04A1409-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit

E04A1409-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit

E04A1409-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal ALS2 Antibody (monoclonal) (M01), Clone: 4F9

APR11388G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ALS2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4F9. This antibody is applicable in WB, E

ALS2 Rabbit Polyclonal Antibody