ALS2 Rabbit Polyclonal Antibody
ALS2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
ALS2 Polyclonal Antibody |
ABP57749-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470 |
ALS2 Polyclonal Antibody |
ABP57749-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470 |
ALS2 Polyclonal Antibody |
ABP57749-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470
- Applications tips:
|
Description: A polyclonal antibody for detection of ALS2 from Human, Mouse, Rat. This ALS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ALS2 protein at amino acid sequence of 390-470 |
ALS2 Rabbit pAb |
A7125-100ul |
Abclonal |
100 ul |
EUR 308 |
ALS2 Rabbit pAb |
A7125-200ul |
Abclonal |
200 ul |
EUR 459 |
ALS2 Rabbit pAb |
A7125-20ul |
Abclonal |
20 ul |
EUR 183 |
ALS2 Rabbit pAb |
A7125-50ul |
Abclonal |
50 ul |
EUR 223 |
ALS2 Rabbit pAb |
A4895-100ul |
Abclonal |
100 ul |
EUR 308 |
ALS2 Rabbit pAb |
A4895-200ul |
Abclonal |
200 ul |
EUR 459 |
ALS2 Rabbit pAb |
A4895-20ul |
Abclonal |
20 ul |
EUR 183 |
ALS2 Rabbit pAb |
A4895-50ul |
Abclonal |
50 ul |
EUR 223 |
ALS2 antibody |
70R-3555 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ALS2 antibody |
ALS2 Antibody |
36087-100ul |
SAB |
100ul |
EUR 252 |
ALS2 antibody |
70R-15692 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ALS2 antibody |
ALS2 Antibody |
DF9196 |
Affbiotech |
200ul |
EUR 304 |
Description: ALS2 Antibody detects endogenous levels of total ALS2. |
ALS2 Antibody |
1-CSB-PA001635GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ALS2 Antibody |
1-CSB-PA598875 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
ALS2 Antibody |
1-CSB-PA857009ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ALS2. Recognizes ALS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal ALS2 / Alsin Antibody (C-Terminus) |
APR11387G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ALS2 / Alsin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal Goat Anti-Alsin / ALS2 Antibody |
APR12066G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Alsin / ALS2 . This antibody is tested and proven to work in the following applications: |
Rabbit Alsin(ALS2) ELISA kit |
E04A1408-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Alsin(ALS2) ELISA kit |
E04A1408-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Alsin(ALS2) ELISA kit |
E04A1408-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Alsin(ALS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ALS2 Conjugated Antibody |
C36087 |
SAB |
100ul |
EUR 397 |
anti- ALS2 antibody |
FNab00350 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IP: 1:200-1:1000
- IHC: 1:20-1:200
- IF: 1:20-1:200
- Immunogen: amyotrophic lateral sclerosis 2(juvenile)
- Uniprot ID: Q96Q42
- Gene ID: 57679
- Research Area: Neuroscience, Cell Division and Proliferation, Signal Tran
- Show more
|
Description: Antibody raised against ALS2 |
Alsin (ALS2) Antibody |
20-abx110962 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
abx036694-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
abx032830-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
abx032830-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
20-abx003718 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
20-abx005380 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
20-abx320212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
abx430481-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Alsin (ALS2) Antibody |
20-abx241184 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Alsin (ALS2) Antibody |
abx230350-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-ALS2 antibody |
STJ29205 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ALS2 antibody |
STJ116266 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ALS2 antibody |
STJ190540 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ALS2 |
ALS2 siRNA |
20-abx900298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ALS2 siRNA |
20-abx907343 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ALS2 siRNA |
20-abx907344 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Alsin/ALS2 |
P41001 |
Neuromics |
100 ug Blocking Peptide |
EUR 239 |
anti-Als2 |
YF-PA20253 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to Als2 |
anti-Als2 |
YF-PA20254 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to Als2 |
anti-ALS2 |
YF-PA27601 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to ALS2 |
ALS2 Blocking Peptide |
33R-1366 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSKS antibody, catalog no. 70R-3083 |
ALS2 cloning plasmid |
CSB-CL857009HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2439
- Sequence: atggactcaaagaagagaagctcaacagaggcagaaggatccaaggaaagaggcctggtccatatctggcaggcaggatcctttcccataacaccagagagattgccaggctggggaggaaagactgttttgcaggcagccctcggagtgaaacatggagttcttctgactgaag
- Show more
|
Description: A cloning plasmid for the ALS2 gene. |
ALS2 Blocking Peptide |
DF9196-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-Als2 (4F9) |
YF-MA19088 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Als2 |
Anti-Als2 (4F10) |
YF-MA19089 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Als2 |
Mouse ALS2 shRNA Plasmid |
20-abx978057 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat ALS2 shRNA Plasmid |
20-abx990523 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ALS2 shRNA Plasmid |
20-abx961625 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit |
E04A1409-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit |
E04A1409-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ALS2 C terminal like protein(ALS2CL) ELISA kit |
E04A1409-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ALS2 C terminal like protein(ALS2CL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monoclonal ALS2 Antibody (monoclonal) (M01), Clone: 4F9 |
APR11388G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ALS2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4F9. This antibody is applicable in WB, E |
ALS2 Rabbit Polyclonal Antibody