AMOT Rabbit Polyclonal Antibody

AMOT Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

Human Angiomotin (AMOT) ELISA Kit

RD-AMOT-Hu-48Tests 48 Tests
EUR 500

Human Angiomotin (AMOT) ELISA Kit

RD-AMOT-Hu-96Tests 96 Tests
EUR 692

Human Angiomotin (AMOT) ELISA Kit

RDR-AMOT-Hu-48Tests 48 Tests
EUR 522

Human Angiomotin (AMOT) ELISA Kit

RDR-AMOT-Hu-96Tests 96 Tests
EUR 724

AMOT Polyclonal Antibody

ES9390-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AMOT Polyclonal Antibody

ES9390-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AMOT Polyclonal Antibody

ABP57755-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT Polyclonal Antibody

ABP57755-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT Polyclonal Antibody

ABP57755-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
  • Applications tips:
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790

AMOT Rabbit pAb

A8075-100ul 100 ul
EUR 308

AMOT Rabbit pAb

A8075-200ul 200 ul
EUR 459

AMOT Rabbit pAb

A8075-20ul 20 ul
EUR 183

AMOT Rabbit pAb

A8075-50ul 50 ul
EUR 223

AMOT Antibody

ABD9208 100 ug
EUR 438

AMOT Antibody

45767-100ul 100ul
EUR 252

AMOT Antibody

45767-50ul 50ul
EUR 187

AMOT antibody

70R-15701 50 ul
EUR 435
Description: Rabbit polyclonal AMOT antibody

AMOT Antibody

DF9208 200ul
EUR 304
Description: AMOT Antibody detects endogenous levels of total AMOT.

AMOT Antibody

1-CSB-PA001677ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

AMOT Antibody

1-CSB-PA001677GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

AMOT antibody

PAab09852 100 ug
EUR 386

Polyclonal Phospho-AMOT(S1041) Antibody

APR05240G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-AMOT(S1041) . This antibody is tested and proven to work in the following applications:

Polyclonal Phospho-AMOT(Y599) Antibody

APR05288G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-AMOT(Y599) . This antibody is tested and proven to work in the following applications:

Rabbit Anti-Human angiomotin (AMOT) (AMOT- phosphor) IgG (aff pure)

AB-23097-A 100ug
EUR 482

AMOT Conjugated Antibody

C45767 100ul
EUR 397

anti- AMOT antibody

FNab00366 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab00367 100µg
EUR 505.25
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab00368 100µg
EUR 505.25
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

anti- AMOT antibody

FNab09852 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: angiomotin
  • Uniprot ID: Q4VCS5
  • Gene ID: 154796
  • Research Area: Cardiovascular, Developmental biology
Description: Antibody raised against AMOT

Angiomotin (AMOT) Antibody

20-abx110972
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx171214
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiomotin (AMOT) Antibody

20-abx148170
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx006609
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx030454-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx030454-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

AMOT (pS1041) Antibody

abx032118-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

AMOT (pS1041) Antibody

abx032118-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

AMOT (pY599) Antibody

abx032202-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

AMOT (pY599) Antibody

abx032202-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx175379
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Angiomotin (AMOT) Antibody

20-abx321581
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

20-abx225032
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Angiomotin (AMOT) Antibody

abx230366-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Angiomotin (AMOT) Antibody

abx230368-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Anti-AMOT antibody

PAab00366 100 ug
EUR 355

anti- AMOT antibody

LSMab09852 100 ug
EUR 386

Anti-AMOT antibody

STJ110378 100 µl
EUR 277
Description: This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-AMOT antibody

STJ190548 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AMOT

AMOT siRNA

20-abx907404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AMOT siRNA

20-abx907405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Human angiomotin (AMOT) control (AMOT- phosphor) peptide

AB-23097-P 100ug
EUR 164

AMOT Blocking Peptide

DF9208-BP 1mg
EUR 195

AMOT cloning plasmid

CSB-CL001677HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2031
  • Sequence: atgcctcgggctcagccatcctctgcttcttatcagccagtgccagcagacccttttgccattgtttccagagcccagcagatggttgagatcctctcagacgagaaccggaacttgaggcaagagttggaaggatgctatgagaaggtggcaagactgcagaaggtggagacag
  • Show more
Description: A cloning plasmid for the AMOT gene.

Rabbit Anti-Human angiomotin (AMOT) IgG (aff pure)

AB-23056-A 100ug
EUR 482

Human Angiomotin (AMOT) Protein

20-abx652505
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse AMOT shRNA Plasmid

20-abx973921
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AMOT shRNA Plasmid

20-abx965801
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AMOT ELISA Kit

ELA-E2294h 96 Tests
EUR 824

AMOT ELISA KIT|Human

EF006274 96 Tests
EUR 689

Human Angiomotin (AMOT) ELISA Kit

abx573197-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human AMOT(Angiomotin) ELISA Kit

EH2205 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: Q4VCS5
  • Alias: AMOT/KIAA1071
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Angiomotin, AMOT ELISA KIT

ELI-07348h 96 Tests
EUR 824

Mouse Angiomotin, Amot ELISA KIT

ELI-07349m 96 Tests
EUR 865

Mouse Amot(Angiomotin) ELISA Kit

EM0757 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q8VHG2
  • Alias: Amot/AMOT/KIAA1071
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Human Angiomotin (AMOT) ELISA Kit

20-abx150646
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Angiomotin (AMOT) CLIA Kit

20-abx493594
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Angiomotin (AMOT) ELISA Kit

abx255105-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Amot/ Angiomotin ELISA Kit

E0089Mo 1 Kit
EUR 571

Human AMOT/ Angiomotin ELISA Kit

E0137Hu 1 Kit
EUR 571

Amot ORF Vector (Mouse) (pORF)

ORF038543 1.0 ug DNA
EUR 506

AMOT ORF Vector (Human) (pORF)

ORF012200 1.0 ug DNA
EUR 354

Human Angiomotin (AMOT) ELISA Kit

SEC296Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids.

AMOT Rabbit Polyclonal Antibody