AMOT Rabbit Polyclonal Antibody
AMOT Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
Human Angiomotin (AMOT) ELISA Kit |
RD-AMOT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Angiomotin (AMOT) ELISA Kit |
RD-AMOT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Angiomotin (AMOT) ELISA Kit |
RDR-AMOT-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Angiomotin (AMOT) ELISA Kit |
RDR-AMOT-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
AMOT Polyclonal Antibody |
ES9390-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AMOT Polyclonal Antibody |
ES9390-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AMOT from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AMOT Polyclonal Antibody |
ABP57755-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
- Applications tips:
|
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790 |
AMOT Polyclonal Antibody |
ABP57755-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
- Applications tips:
|
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790 |
AMOT Polyclonal Antibody |
ABP57755-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790
- Applications tips:
|
Description: A polyclonal antibody for detection of AMOT from Human, Mouse. This AMOT antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AMOT protein at amino acid sequence of 710-790 |
AMOT Rabbit pAb |
A8075-100ul |
Abclonal |
100 ul |
EUR 308 |
AMOT Rabbit pAb |
A8075-200ul |
Abclonal |
200 ul |
EUR 459 |
AMOT Rabbit pAb |
A8075-20ul |
Abclonal |
20 ul |
EUR 183 |
AMOT Rabbit pAb |
A8075-50ul |
Abclonal |
50 ul |
EUR 223 |
AMOT Antibody |
45767-100ul |
SAB |
100ul |
EUR 252 |
AMOT Antibody |
45767-50ul |
SAB |
50ul |
EUR 187 |
AMOT antibody |
70R-15701 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal AMOT antibody |
AMOT Antibody |
DF9208 |
Affbiotech |
200ul |
EUR 304 |
Description: AMOT Antibody detects endogenous levels of total AMOT. |
AMOT Antibody |
1-CSB-PA001677ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
AMOT Antibody |
1-CSB-PA001677GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against AMOT. Recognizes AMOT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Phospho-AMOT(S1041) Antibody |
APR05240G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-AMOT(S1041) . This antibody is tested and proven to work in the following applications: |
Polyclonal Phospho-AMOT(Y599) Antibody |
APR05288G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-AMOT(Y599) . This antibody is tested and proven to work in the following applications: |
Rabbit Anti-Human angiomotin (AMOT) (AMOT- phosphor) IgG (aff pure) |
AB-23097-A |
Alpha Diagnostics |
100ug |
EUR 482 |
AMOT Conjugated Antibody |
C45767 |
SAB |
100ul |
EUR 397 |
anti- AMOT antibody |
FNab00366 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- Immunogen: angiomotin
- Uniprot ID: Q4VCS5
- Gene ID: 154796
- Research Area: Cardiovascular, Developmental biology
|
Description: Antibody raised against AMOT |
anti- AMOT antibody |
FNab00367 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: angiomotin
- Uniprot ID: Q4VCS5
- Gene ID: 154796
- Research Area: Cardiovascular, Developmental biology
|
Description: Antibody raised against AMOT |
anti- AMOT antibody |
FNab00368 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:1000-1:10000
- IHC: 1:20-1:200
- Immunogen: angiomotin
- Uniprot ID: Q4VCS5
- Gene ID: 154796
- Research Area: Cardiovascular, Developmental biology
|
Description: Antibody raised against AMOT |
anti- AMOT antibody |
FNab09852 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:200-1:1000
- IHC: 1:50-1:500
- IF: 1:20-1:200
- Immunogen: angiomotin
- Uniprot ID: Q4VCS5
- Gene ID: 154796
- Research Area: Cardiovascular, Developmental biology
|
Description: Antibody raised against AMOT |
Angiomotin (AMOT) Antibody |
20-abx110972 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
20-abx171214 |
Abbexa |
|
|
|
Angiomotin (AMOT) Antibody |
20-abx148170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
20-abx006609 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
abx030454-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
abx030454-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
AMOT (pS1041) Antibody |
abx032118-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
AMOT (pS1041) Antibody |
abx032118-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
AMOT (pY599) Antibody |
abx032202-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
AMOT (pY599) Antibody |
abx032202-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
20-abx175379 |
Abbexa |
|
|
|
Angiomotin (AMOT) Antibody |
20-abx321581 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
20-abx225032 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Angiomotin (AMOT) Antibody |
abx230366-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Angiomotin (AMOT) Antibody |
abx230368-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-AMOT antibody |
STJ110378 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. |
Anti-AMOT antibody |
STJ190548 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AMOT |
AMOT siRNA |
20-abx907404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AMOT siRNA |
20-abx907405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human angiomotin (AMOT) control (AMOT- phosphor) peptide |
AB-23097-P |
Alpha Diagnostics |
100ug |
EUR 164 |
AMOT Blocking Peptide |
DF9208-BP |
Affbiotech |
1mg |
EUR 195 |
AMOT cloning plasmid |
CSB-CL001677HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2031
- Sequence: atgcctcgggctcagccatcctctgcttcttatcagccagtgccagcagacccttttgccattgtttccagagcccagcagatggttgagatcctctcagacgagaaccggaacttgaggcaagagttggaaggatgctatgagaaggtggcaagactgcagaaggtggagacag
- Show more
|
Description: A cloning plasmid for the AMOT gene. |
Rabbit Anti-Human angiomotin (AMOT) IgG (aff pure) |
AB-23056-A |
Alpha Diagnostics |
100ug |
EUR 482 |
Human Angiomotin (AMOT) Protein |
20-abx652505 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse AMOT shRNA Plasmid |
20-abx973921 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AMOT shRNA Plasmid |
20-abx965801 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Angiomotin (AMOT) ELISA Kit |
abx573197-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human AMOT(Angiomotin) ELISA Kit |
EH2205 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.78-50 ng/ml
- Uniprot ID: Q4VCS5
- Alias: AMOT/KIAA1071
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml |
Mouse Amot(Angiomotin) ELISA Kit |
EM0757 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q8VHG2
- Alias: Amot/AMOT/KIAA1071
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml |
Human Angiomotin (AMOT) ELISA Kit |
20-abx150646 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Angiomotin (AMOT) CLIA Kit |
20-abx493594 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Angiomotin (AMOT) ELISA Kit |
abx255105-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Amot/ Angiomotin ELISA Kit |
E0089Mo |
Sunlong |
1 Kit |
EUR 571 |
Human AMOT/ Angiomotin ELISA Kit |
E0137Hu |
Sunlong |
1 Kit |
EUR 571 |
Amot ORF Vector (Mouse) (pORF) |
ORF038543 |
ABM |
1.0 ug DNA |
EUR 506 |
AMOT ORF Vector (Human) (pORF) |
ORF012200 |
ABM |
1.0 ug DNA |
EUR 354 |
Human Angiomotin (AMOT) ELISA Kit |
SEC296Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Angiomotin (AMOT) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Angiomotin (AMOT) in Tissue homogenates, cell lysates and other biological fluids. |
AMOT Rabbit Polyclonal Antibody