APBB1 Rabbit Polyclonal Antibody

APBB1 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

APBB1 Polyclonal Antibody

ABP57787-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480
  • Applications tips:
Description: A polyclonal antibody for detection of APBB1 from Human, Mouse, Rat. This APBB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480

APBB1 Polyclonal Antibody

ABP57787-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480
  • Applications tips:
Description: A polyclonal antibody for detection of APBB1 from Human, Mouse, Rat. This APBB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480

APBB1 Polyclonal Antibody

ABP57787-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480
  • Applications tips:
Description: A polyclonal antibody for detection of APBB1 from Human, Mouse, Rat. This APBB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human APBB1 protein at amino acid sequence of 400-480

APBB1 Rabbit pAb

A1944-100ul 100 ul
EUR 308

APBB1 Rabbit pAb

A1944-200ul 200 ul
EUR 459

APBB1 Rabbit pAb

A1944-20ul 20 ul
EUR 183

APBB1 Rabbit pAb

A1944-50ul 50 ul
EUR 223

Apbb1 antibody

70R-9328 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Apbb1 antibody

APBB1 Antibody

ABD6708 100 ug
EUR 438

APBB1 Antibody

32511-100ul 100ul
EUR 252

APBB1 antibody

70R-15759 50 ul
EUR 435
Description: Rabbit polyclonal APBB1 antibody

APBB1 Antibody

DF6708 200ul
EUR 304
Description: APBB1 Antibody detects endogenous levels of total APBB1.

APBB1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against APBB1. Recognizes APBB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

APBB1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against APBB1. Recognizes APBB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal Goat Anti-APBB1 / FE65 Antibody

APR12071G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-APBB1 / FE65 . This antibody is tested and proven to work in the following applications:

Apbb1/ Rat Apbb1 ELISA Kit

ELI-23876r 96 Tests
EUR 886

APBB1 Conjugated Antibody

C32511 100ul
EUR 397

Anti-APBB1 antibody

STJ26186 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene.

Anti-APBB1 antibody

STJ190544 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to APBB1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-FE65/APBB1 Antibody

PB9684 100ug/vial
EUR 334

Anti-FE65/APBB1 Antibody

RP1059 100ug/vial
EUR 294

Anti-APBB1 / FE65 antibody

STJ70979 100 µg
EUR 359

Human APBB1 Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Apbb1 Blocking Peptide

33R-1963 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Apbb1 antibody, catalog no. 70R-9328

APBB1 Blocking Peptide

DF6708-BP 1mg
EUR 195

APBB1 cloning plasmid

CSB-CL001890HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2127
  • Sequence: atgtctgttccatcatcactgagccagtcggccattaatgccaacagccacggaggccccgcactgagcctacccctgcctctgcacgctgcccacaaccagctgctcaacgccaagctgcaggccacagctgtgggacccaaggacctgcgcagcgccatgggggagggtggtg
  • Show more
Description: A cloning plasmid for the APBB1 gene.

Rat APBB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-24343h 96 Tests
EUR 824

Mouse Apbb1 ELISA KIT

ELI-49577m 96 Tests
EUR 865

Human APBB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse APBB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

APBB1 Recombinant Protein (Human)

RP001477 100 ug Ask for price

APBB1 Recombinant Protein (Rat)

RP190475 100 ug Ask for price

APBB1 Recombinant Protein (Mouse)

RP116315 100 ug Ask for price

APBB1 Recombinant Protein (Mouse)

RP116318 100 ug Ask for price

APBB1 Recombinant Protein (Mouse)

RP116321 100 ug Ask for price

APBB1 Recombinant Protein (Mouse)

RP116324 100 ug Ask for price

APBB1 ORF Vector (Human) (pORF)

ORF000493 1.0 ug DNA
EUR 95

Apbb1 ORF Vector (Mouse) (pORF)

ORF038773 1.0 ug DNA
EUR 506

Apbb1 ORF Vector (Mouse) (pORF)

ORF038774 1.0 ug DNA
EUR 506

Apbb1 ORF Vector (Mouse) (pORF)

ORF038775 1.0 ug DNA
EUR 506

Apbb1 ORF Vector (Mouse) (pORF)

ORF038776 1.0 ug DNA
EUR 506

Apbb1 ORF Vector (Rat) (pORF)

ORF063493 1.0 ug DNA
EUR 506

APBB1 sgRNA CRISPR Lentivector set (Human)

K0102401 3 x 1.0 ug
EUR 339

Apbb1 sgRNA CRISPR Lentivector set (Mouse)

K3724801 3 x 1.0 ug
EUR 339

Apbb1 sgRNA CRISPR Lentivector set (Rat)

K6885801 3 x 1.0 ug
EUR 339

Amyloid beta (A4) protein-binding family B member 1 (APBB1, Fe65) polyclonal antibody

ABP-PAB-10413 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

Amyloid beta (A4) protein-binding family B member 1 (APBB1, Fe65) polyclonal antibody

ABP-PAB-10620 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:

APBB1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0102402 1.0 ug DNA
EUR 154

APBB1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0102403 1.0 ug DNA
EUR 154

APBB1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0102404 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3724802 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3724803 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3724804 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6885802 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6885803 1.0 ug DNA
EUR 154

Apbb1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6885804 1.0 ug DNA
EUR 154

APBB1 Protein Vector (Human) (pPB-C-His)

PV001969 500 ng
EUR 329

APBB1 Protein Vector (Human) (pPB-N-His)

PV001970 500 ng
EUR 329

APBB1 Protein Vector (Human) (pPM-C-HA)

PV001971 500 ng
EUR 329

APBB1 Protein Vector (Human) (pPM-C-His)

PV001972 500 ng
EUR 329

APBB1 Protein Vector (Mouse) (pPB-C-His)

PV155090 500 ng
EUR 1065

APBB1 Protein Vector (Mouse) (pPB-N-His)

PV155091 500 ng
EUR 1065

APBB1 Protein Vector (Mouse) (pPM-C-HA)

PV155092 500 ng
EUR 1065

APBB1 Protein Vector (Mouse) (pPM-C-His)

PV155093 500 ng
EUR 1065

APBB1 Rabbit Polyclonal Antibody