AQP8 Rabbit Polyclonal Antibody

AQP8 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

AQP8 Polyclonal Antibody

ABP57800-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

AQP8 Polyclonal Antibody

ABP57800-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

AQP8 Polyclonal Antibody

ABP57800-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of AQP8 from Human, Mouse, Rat. This AQP8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP8 protein at amino acid sequence of 70-150

Human Aquaporin 8 (AQP8) ELISA Kit

DLR-AQP8-Hu-48T 48T
EUR 517
  • Should the Human Aquaporin 8 (AQP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 8 (AQP8) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

DLR-AQP8-Hu-96T 96T
EUR 673
  • Should the Human Aquaporin 8 (AQP8) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 8 (AQP8) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Aquaporin 8 (AQP8) ELISA Kit

RD-AQP8-Hu-48Tests 48 Tests
EUR 521

Human Aquaporin 8 (AQP8) ELISA Kit

RD-AQP8-Hu-96Tests 96 Tests
EUR 723

Human Aquaporin 8 (AQP8) ELISA Kit

RDR-AQP8-Hu-48Tests 48 Tests
EUR 544

Human Aquaporin 8 (AQP8) ELISA Kit

RDR-AQP8-Hu-96Tests 96 Tests
EUR 756

AQP8 Rabbit pAb

A8539-100ul 100 ul
EUR 308

AQP8 Rabbit pAb

A8539-200ul 200 ul
EUR 459

AQP8 Rabbit pAb

A8539-20ul 20 ul
EUR 183

AQP8 Rabbit pAb

A8539-50ul 50 ul
EUR 223

AQP8 Antibody

ABD9224 100 ug
EUR 438

AQP8 Antibody

36812-100ul 100ul
EUR 252

AQP8 antibody

70R-14050 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal AQP8 antibody

AQP8 Antibody

DF9224 200ul
EUR 304
Description: AQP8 Antibody detects endogenous levels of total AQP8.

AQP8 Antibody

1-CSB-PA905788
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AQP8. Recognizes AQP8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:25-1:100

AQP8 Antibody

1-CSB-PA186529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AQP8. Recognizes AQP8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:10000, IHC:1:50-1:200

Aquaporin 8 (AQP8) Polyclonal Antibody (Human)

4-PAD031Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8)

AQP8 Conjugated Antibody

C36812 100ul
EUR 397

Anti-AQP8 antibody

STJ111278 100 µl
EUR 277
Description: Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 8 mRNA is found in pancreas and colon but not other tissues.

Anti-AQP8 antibody

STJ190560 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AQP8

Aqp8/ Rat Aqp8 ELISA Kit

ELI-34512r 96 Tests
EUR 886

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), APC

4-PAD031Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with APC.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), Biotinylated

4-PAD031Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with Biotin.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), Cy3

4-PAD031Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with Cy3.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), FITC

4-PAD031Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with FITC.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), HRP

4-PAD031Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with HRP.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), PE

4-PAD031Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with PE.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Aquaporin-8(AQP8) ELISA kit

E04A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AQP8 siRNA

20-abx900394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP8 siRNA

20-abx907899
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP8 siRNA

20-abx907900
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx123590
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx130491
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aquaporin 8 (AQP8) Antibody

20-abx339081
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx339090
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 8 (AQP8) Antibody

20-abx171307
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Aquaporin 8 (AQP8) Polyclonal Antibody (Human), APC-Cy7

4-PAD031Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP8 (Lys129~Trp228)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Aquaporin 8 (AQP8). This antibody is labeled with APC-Cy7.

AQP8 Blocking Peptide

DF9224-BP 1mg
EUR 195

AQP8 cloning plasmid

CSB-CL001972HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgtgtgagcctgaatttggcaatgacaaggccagggagccgagcgtgggtggcaggtggcgagtgtcctggtacgaacggtttgtgcagccatgtctggtcgaactgctgggctctgctctcttcatcttcatcgggtgcctgtcggtcattgagaatgggacggacactgggct
  • Show more
Description: A cloning plasmid for the AQP8 gene.

Anti-Aquaporin 8/AQP8 Antibody

PA1511 100ug/vial
EUR 294

Rabbit Anti-Rat Aquaporin 8 (AQP8) Antiserum # 1

AQP81-S 100 ul
EUR 457

Rat AQP8 shRNA Plasmid

20-abx985331
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AQP8 shRNA Plasmid

20-abx950241
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse AQP8 shRNA Plasmid

20-abx969210
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Aquaporin 8 (AQP8)

4-RPD031Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O94778
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 40.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Aquaporin 8 expressed in: E.coli

AQP8 Recombinant Protein (Human)

RP001657 100 ug Ask for price

pCMV-SPORT6-AQP8 Plasmid

PVT16842 2 ug
EUR 325

AQP8 Recombinant Protein (Rat)

RP190655 100 ug Ask for price

AQP8 Recombinant Protein (Mouse)

RP116615 100 ug Ask for price

AQP8 Recombinant Protein (Mouse)

RP116618 100 ug Ask for price

Monoclonal AQP8 Antibody (monoclonal) (M01), Clone: 1A1

APG01969G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human AQP8 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1A1. This antibody is applicable in WB, E

Monoclonal AQP8 Antibody (monoclonal) (M03), Clone: 1F8

APG01970G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human AQP8 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1F8. This antibody is applicable in WB and IHC

Rabbit Anti-Rat Aquaporin 8 (AQP8) IgG # 1, aff pure

AQP81-A 100 ug
EUR 482

Human Aquaporin 8 (AQP8) Protein

20-abx650276
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

AQP8 ORF Vector (Human) (pORF)

ORF000553 1.0 ug DNA
EUR 95

Aqp8 ORF Vector (Mouse) (pORF)

ORF038873 1.0 ug DNA
EUR 506

Aqp8 ORF Vector (Mouse) (pORF)

ORF038874 1.0 ug DNA
EUR 506

Aqp8 ORF Vector (Rat) (pORF)

ORF063553 1.0 ug DNA
EUR 506

pECMV-Aqp8-m-FLAG Plasmid

PVT15303 2 ug
EUR 325

AQP8 ELISA Kit (Human) (OKCD00891)

OKCD00891 96 Wells
EUR 831
Description: Description of target: Forms a water-specific channel; mercury-sensitive. Not permeable to glycerol or urea. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

Human Aquaporin 8 (AQP8) ELISA Kit

abx572448-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Aquaporin-8(AQP8) ELISA kit

E06A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Aquaporin-8(AQP8) ELISA kit

E03A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Aquaporin-8(AQP8) ELISA kit

E01A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Aquaporin-8(AQP8) ELISA kit

E02A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Aquaporin-8(AQP8) ELISA kit

E07A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Aquaporin-8(AQP8) ELISA kit

E09A1618-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Aquaporin-8(AQP8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AQP8 Rabbit Polyclonal Antibody