AQP9 Rabbit Polyclonal Antibody

AQP9 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

AQP9 Polyclonal Antibody

ABP57801-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AQP9 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of AQP9 from Human, Mouse, Rat. This AQP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP9 protein at amino acid sequence of 160-240

AQP9 Polyclonal Antibody

ES9403-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AQP9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

AQP9 Polyclonal Antibody

ES9403-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AQP9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Aquaporin 9 (AQP9) ELISA Kit

DLR-AQP9-Hu-48T 48T
EUR 479
  • Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aquaporin 9 (AQP9) ELISA Kit

DLR-AQP9-Hu-96T 96T
EUR 621
  • Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Aquaporin 9 (AQP9) ELISA Kit

RDR-AQP9-Hu-48Tests 48 Tests
EUR 500

Human Aquaporin 9 (AQP9) ELISA Kit

RDR-AQP9-Hu-96Tests 96 Tests
EUR 692

Human Aquaporin 9 (AQP9) ELISA Kit

RD-AQP9-Hu-48Tests 48 Tests
EUR 478

Human Aquaporin 9 (AQP9) ELISA Kit

RD-AQP9-Hu-96Tests 96 Tests
EUR 662

AQP9 Rabbit pAb

A8540-100ul 100 ul
EUR 308

AQP9 Rabbit pAb

A8540-200ul 200 ul
EUR 459

AQP9 Rabbit pAb

A8540-20ul 20 ul
EUR 183

AQP9 Rabbit pAb

A8540-50ul 50 ul
EUR 223

AQP9 Antibody

43256-100ul 100ul
EUR 252

AQP9 Antibody

DF9225 200ul
EUR 304
Description: AQP9 Antibody detects endogenous levels of total AQP9.

AQP9 Antibody

ABD9225 100 ug
EUR 438

AQP9 antibody

PAab09925 100 ug
EUR 386

AQP9 Conjugated Antibody

C43256 100ul
EUR 397

anti- AQP9 antibody

FNab09925 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: Aquaporin-9
  • Uniprot ID: O43315
  • Gene ID: 366
  • Research Area: Metabolism, Signal Transduction
Description: Antibody raised against AQP9

anti- AQP9 antibody

LSMab09925 100 ug
EUR 386

Anti-AQP9 antibody

STJ111279 100 µl
EUR 277
Description: The aquaporins are a family of water-selective membrane channels. This gene encodes a member of a subset of aquaporins called the aquaglyceroporins. This protein allows passage of a broad range of noncharged solutes and also stimulates urea transport and osmotic water permeability. This protein may also facilitate the uptake of glycerol in hepatic tissue. The encoded protein may also play a role in specialized leukocyte functions such as immunological response and bactericidal activity. Alternate splicing results in multiple transcript variants.

Anti-AQP9 antibody

STJ13100023 100 µl
EUR 427

Anti-AQP9 antibody

STJ190561 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AQP9

AQP9 siRNA

20-abx900395
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP9 siRNA

20-abx907901
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AQP9 siRNA

20-abx907902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Aquaporin 9 (AQP9) Antibody

20-abx175458
  • EUR 1107.00
  • EUR 537.00
  • 1 mg
  • 200 ug
  • Please enquire.

Aquaporin 9 (AQP9) Antibody

20-abx123634
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Aquaporin 9 (AQP9) Antibody

abx037559-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Aquaporin 9 (AQP9) Antibody

abx038251-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Aquaporin 9 (AQP9) Antibody

20-abx129640
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Aquaporin 9 (AQP9) Antibody

abx148282-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Aquaporin 9 (AQP9) Antibody

20-abx171308
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat)

4-PAA578Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9)

AQP9 Blocking Peptide

DF9225-BP 1mg
EUR 195

AQP9 cloning plasmid

CSB-CL001973HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atgcagcctgagggagcagaaaagggaaaaagcttcaagcagagactggtcttgaagagcagcttagcgaaagaaaccctctctgagttcttgggcacgttcatcttgattgtccttggatgtggctgtgttgcccaagctattctcagtcgaggacgttttggaggggtcatcac
  • Show more
Description: A cloning plasmid for the AQP9 gene.

Anti-AQP9/Aquaporin 9 Antibody

A03638 100ul
EUR 397
Description: Rabbit Polyclonal AQP9/Aquaporin 9 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Aquaporin 9/AQP9 Antibody

A03638-1 100ug/vial
EUR 294

Anti-Aquaporin 9/AQP9 Antibody

PA2094 100ug/vial
EUR 294

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAA578Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with APC.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAA578Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with Biotin.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAA578Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with Cy3.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAA578Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with FITC.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAA578Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with HRP.

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAA578Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with PE.

Rabbit Anti-Rat Aquaporin 9 (AQP9) Antiserum # 1

AQP91-S 100 ul
EUR 457

Human AQP9 ELISA Kit

ELA-E2218h 96 Tests
EUR 824

Anserini AQP9 ELISA Kit

EAA0476 96Tests
EUR 521

AQP9 ELISA KIT|Human

EF006237 96 Tests
EUR 689

Mouse AQP9 shRNA Plasmid

20-abx975243
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat AQP9 shRNA Plasmid

20-abx986384
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human AQP9 shRNA Plasmid

20-abx950261
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Aquaporin 9 (AQP9)

4-RPA578Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9JJJ3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.1kDa
  • Isoelectric Point: 7.7
Description: Recombinant Mouse Aquaporin 9 expressed in: E.coli

pIRES2-DsRed2-AQP9 Plasmid

PVTB00902-2a 2 ug
EUR 356

AQP9 Recombinant Protein (Human)

RP001660 100 ug Ask for price

AQP9 Recombinant Protein (Mouse)

RP116621 100 ug Ask for price

AQP9 Recombinant Protein (Rat)

RP190658 100 ug Ask for price

Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAA578Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AQP9 (Glu4~Asn285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with APC-Cy7.

Rabbit Anti-Rat Aquaporin 9 (AQP9) IgG # 1, aff pure

AQP91-A 100 ug
EUR 482

Mouse Aquaporin 9 (AQP9) Protein

20-abx167407
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Aquaporin 9 (AQP9) Protein

20-abx652573
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Aqp9 ORF Vector (Rat) (pORF)

ORF063554 1.0 ug DNA
EUR 506

AQP9 ORF Vector (Human) (pORF)

ORF000554 1.0 ug DNA
EUR 95

Aqp9 ORF Vector (Mouse) (pORF)

ORF038875 1.0 ug DNA
EUR 506

AQP9 ELISA Kit (Human) (OKAN05843)

OKAN05843 96 Wells
EUR 792
Description: Description of target: The aquaporins are a family of water-selective membrane channels. This gene encodes a member of a subset of aquaporins called the aquaglyceroporins. This protein allows passage of a broad range of noncharged solutes and also stimulates urea transport and osmotic water permeability. This protein may also facilitate the uptake of glycerol in hepatic tissue . The encoded protein may also play a role in specialized leukocyte functions such as immunological response and bactericidal activity. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL

AQP9 ELISA Kit (Human) (OKCD06530)

OKCD06530 96 Wells
EUR 753
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na(+), K(+), Cl(-), and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL

AQP9 ELISA Kit (Mouse) (OKEH05212)

OKEH05212 96 Wells
EUR 662
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

AQP9 ELISA Kit (Rat) (OKEH06036)

OKEH06036 96 Wells
EUR 662
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.421 ng/mL

AQP9 ELISA Kit (Rat) (OKEH06770)

OKEH06770 96 Wells
EUR 662
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL

AQP9 ELISA Kit (Human) (OKEH06859)

OKEH06859 96 Wells
EUR 662
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL

AQP9 ELISA Kit (Pig) (OKWB00339)

OKWB00339 96 Wells
EUR 572
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Rabbit Anti-AQP1-AQP9 Antiserum (25 ul each of AQP1-9)

AQP19-PAN-S 25 ul x9
EUR 895

Rat Aqp9/ Aquaporin-9 ELISA Kit

E0092Ra 1 Kit
EUR 571

Mouse Aqp9/ Aquaporin-9 ELISA Kit

E0127Mo 1 Kit
EUR 571

Human AQP9/ Aquaporin-9 ELISA Kit

E0195Hu 1 Kit
EUR 571

Human Aquaporin 9 (AQP9) ELISA Kit

20-abx150733
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Aquaporin 9 (AQP9) ELISA Kit

20-abx259110
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human AQP9(Aquaporin-9) ELISA Kit

EH2162 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43315
  • Alias: AQP9(Aquaporin-9)/Aquaglyceroporin-9/Small solute channel 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Aquaporin- 9, Aqp9 ELISA KIT

ELI-07088m 96 Tests
EUR 865

Rat Aquaporin- 9, Aqp9 ELISA KIT

ELI-07089r 96 Tests
EUR 886

Human Aquaporin- 9, AQP9 ELISA KIT

ELI-07090h 96 Tests
EUR 824

Human Aquaporin 9 (AQP9) ELISA Kit

abx570057-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Aquaporin 9 (AQP9) ELISA Kit

abx519750-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Aquaporin 9 (AQP9) ELISA Kit

abx519751-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Aquaporin 9 (AQP9) CLIA Kit

20-abx491704
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

AQP9 Rabbit Polyclonal Antibody