AQP9 Rabbit Polyclonal Antibody
AQP9 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
AQP9 Polyclonal Antibody |
ABP57801-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AQP9 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of AQP9 from Human, Mouse, Rat. This AQP9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AQP9 protein at amino acid sequence of 160-240 |
AQP9 Polyclonal Antibody |
ES9403-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AQP9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AQP9 Polyclonal Antibody |
ES9403-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AQP9 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Aquaporin 9 (AQP9) ELISA Kit |
DLR-AQP9-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Aquaporin 9 (AQP9) ELISA Kit |
DLR-AQP9-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Aquaporin 9 (AQP9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Aquaporin 9 (AQP9) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Aquaporin 9 (AQP9) ELISA Kit |
RDR-AQP9-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Aquaporin 9 (AQP9) ELISA Kit |
RDR-AQP9-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Aquaporin 9 (AQP9) ELISA Kit |
RD-AQP9-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Aquaporin 9 (AQP9) ELISA Kit |
RD-AQP9-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
AQP9 Rabbit pAb |
A8540-100ul |
Abclonal |
100 ul |
EUR 308 |
AQP9 Rabbit pAb |
A8540-200ul |
Abclonal |
200 ul |
EUR 459 |
AQP9 Rabbit pAb |
A8540-20ul |
Abclonal |
20 ul |
EUR 183 |
AQP9 Rabbit pAb |
A8540-50ul |
Abclonal |
50 ul |
EUR 223 |
AQP9 Antibody |
43256-100ul |
SAB |
100ul |
EUR 252 |
AQP9 Antibody |
DF9225 |
Affbiotech |
200ul |
EUR 304 |
Description: AQP9 Antibody detects endogenous levels of total AQP9. |
AQP9 Conjugated Antibody |
C43256 |
SAB |
100ul |
EUR 397 |
anti- AQP9 antibody |
FNab09925 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- Immunogen: Aquaporin-9
- Uniprot ID: O43315
- Gene ID: 366
- Research Area: Metabolism, Signal Transduction
|
Description: Antibody raised against AQP9 |
Anti-AQP9 antibody |
STJ111279 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The aquaporins are a family of water-selective membrane channels. This gene encodes a member of a subset of aquaporins called the aquaglyceroporins. This protein allows passage of a broad range of noncharged solutes and also stimulates urea transport and osmotic water permeability. This protein may also facilitate the uptake of glycerol in hepatic tissue. The encoded protein may also play a role in specialized leukocyte functions such as immunological response and bactericidal activity. Alternate splicing results in multiple transcript variants. |
Anti-AQP9 antibody |
STJ190561 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AQP9 |
AQP9 siRNA |
20-abx900395 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AQP9 siRNA |
20-abx907901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AQP9 siRNA |
20-abx907902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aquaporin 9 (AQP9) Antibody |
20-abx175458 |
Abbexa |
|
|
|
Aquaporin 9 (AQP9) Antibody |
20-abx123634 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Aquaporin 9 (AQP9) Antibody |
abx037559-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Aquaporin 9 (AQP9) Antibody |
abx038251-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Aquaporin 9 (AQP9) Antibody |
20-abx129640 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Aquaporin 9 (AQP9) Antibody |
abx148282-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Aquaporin 9 (AQP9) Antibody |
20-abx171308 |
Abbexa |
|
|
|
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat) |
4-PAA578Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9) |
AQP9 Blocking Peptide |
DF9225-BP |
Affbiotech |
1mg |
EUR 195 |
AQP9 cloning plasmid |
CSB-CL001973HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 888
- Sequence: atgcagcctgagggagcagaaaagggaaaaagcttcaagcagagactggtcttgaagagcagcttagcgaaagaaaccctctctgagttcttgggcacgttcatcttgattgtccttggatgtggctgtgttgcccaagctattctcagtcgaggacgttttggaggggtcatcac
- Show more
|
Description: A cloning plasmid for the AQP9 gene. |
Anti-AQP9/Aquaporin 9 Antibody |
A03638 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal AQP9/Aquaporin 9 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-Aquaporin 9/AQP9 Antibody |
A03638-1 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-Aquaporin 9/AQP9 Antibody |
PA2094 |
BosterBio |
100ug/vial |
EUR 294 |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), APC |
4-PAA578Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with APC. |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated |
4-PAA578Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with Biotin. |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), Cy3 |
4-PAA578Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with Cy3. |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), FITC |
4-PAA578Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with FITC. |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), HRP |
4-PAA578Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with HRP. |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), PE |
4-PAA578Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with PE. |
Rabbit Anti-Rat Aquaporin 9 (AQP9) Antiserum # 1 |
AQP91-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
Anserini AQP9 ELISA Kit |
EAA0476 |
Abclonal |
96Tests |
EUR 521 |
Mouse AQP9 shRNA Plasmid |
20-abx975243 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat AQP9 shRNA Plasmid |
20-abx986384 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AQP9 shRNA Plasmid |
20-abx950261 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Recombinant Aquaporin 9 (AQP9) |
4-RPA578Mu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9JJJ3
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 34.1kDa
- Isoelectric Point: 7.7
|
Description: Recombinant Mouse Aquaporin 9 expressed in: E.coli |
AQP9 Recombinant Protein (Human) |
RP001660 |
ABM |
100 ug |
Ask for price |
AQP9 Recombinant Protein (Mouse) |
RP116621 |
ABM |
100 ug |
Ask for price |
AQP9 Recombinant Protein (Rat) |
RP190658 |
ABM |
100 ug |
Ask for price |
Aquaporin 9 (AQP9) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7 |
4-PAA578Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: AQP9 (Glu4~Asn285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Aquaporin 9 (AQP9). This antibody is labeled with APC-Cy7. |
Rabbit Anti-Rat Aquaporin 9 (AQP9) IgG # 1, aff pure |
AQP91-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
Mouse Aquaporin 9 (AQP9) Protein |
20-abx167407 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Aquaporin 9 (AQP9) Protein |
20-abx652573 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Aqp9 ORF Vector (Rat) (pORF) |
ORF063554 |
ABM |
1.0 ug DNA |
EUR 506 |
AQP9 ORF Vector (Human) (pORF) |
ORF000554 |
ABM |
1.0 ug DNA |
EUR 95 |
Aqp9 ORF Vector (Mouse) (pORF) |
ORF038875 |
ABM |
1.0 ug DNA |
EUR 506 |
AQP9 ELISA Kit (Human) (OKAN05843) |
OKAN05843 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: The aquaporins are a family of water-selective membrane channels. This gene encodes a member of a subset of aquaporins called the aquaglyceroporins. This protein allows passage of a broad range of noncharged solutes and also stimulates urea transport and osmotic water permeability. This protein may also facilitate the uptake of glycerol in hepatic tissue . The encoded protein may also play a role in specialized leukocyte functions such as immunological response and bactericidal activity. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL |
AQP9 ELISA Kit (Human) (OKCD06530) |
OKCD06530 |
Aviva Systems Biology |
96 Wells |
EUR 753 |
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na(+), K(+), Cl(-), and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.4pg/mL |
AQP9 ELISA Kit (Mouse) (OKEH05212) |
OKEH05212 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
AQP9 ELISA Kit (Rat) (OKEH06036) |
OKEH06036 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.421 ng/mL |
AQP9 ELISA Kit (Rat) (OKEH06770) |
OKEH06770 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78 ng/mL |
AQP9 ELISA Kit (Human) (OKEH06859) |
OKEH06859 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Forms a channel with a broad specificity. Mediates passage of a wide variety of non-charged solutes including carbamides, polyols, purines, and pyrimidines in a phloretin- and mercury-sensitive manner, whereas amino acids, cyclic sugars, Na+, K+, Cl-, and deprotonated monocarboxylates are excluded. Also permeable to urea and glycerol.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098 ng/mL |
AQP9 ELISA Kit (Pig) (OKWB00339) |
OKWB00339 |
Aviva Systems Biology |
96 Wells |
EUR 572 |
Description: Description of target: ;Species reactivity: Pig;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
Rabbit Anti-AQP1-AQP9 Antiserum (25 ul each of AQP1-9) |
AQP19-PAN-S |
Alpha Diagnostics |
25 ul x9 |
EUR 895 |
Rat Aqp9/ Aquaporin-9 ELISA Kit |
E0092Ra |
Sunlong |
1 Kit |
EUR 571 |
Mouse Aqp9/ Aquaporin-9 ELISA Kit |
E0127Mo |
Sunlong |
1 Kit |
EUR 571 |
Human AQP9/ Aquaporin-9 ELISA Kit |
E0195Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Aquaporin 9 (AQP9) ELISA Kit |
20-abx150733 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Pig Aquaporin 9 (AQP9) ELISA Kit |
20-abx259110 |
Abbexa |
-
EUR 7645.00
-
EUR 4074.00
-
EUR 942.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-12 working days.
|
Human AQP9(Aquaporin-9) ELISA Kit |
EH2162 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: O43315
- Alias: AQP9(Aquaporin-9)/Aquaglyceroporin-9/Small solute channel 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Aquaporin 9 (AQP9) ELISA Kit |
abx570057-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Aquaporin 9 (AQP9) ELISA Kit |
abx519750-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Aquaporin 9 (AQP9) ELISA Kit |
abx519751-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Aquaporin 9 (AQP9) CLIA Kit |
20-abx491704 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
AQP9 Rabbit Polyclonal Antibody