ARSJ Rabbit Polyclonal Antibody

ARSJ Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

ARSJ Polyclonal Antibody

ES9407-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ARSJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ARSJ Polyclonal Antibody

ES9407-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ARSJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ARSJ Antibody

45775-100ul 100ul
EUR 252

ARSJ Antibody

45775-50ul 50ul
EUR 187

ARSJ Antibody

DF9229 200ul
EUR 304
Description: ARSJ Antibody detects endogenous levels of total ARSJ.

ARSJ Antibody

ABD9229 100 ug
EUR 438

Polyclonal ARSJ Antibody - C-terminal region

APR15076G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ARSJ - C-terminal region. This antibody is tested and proven to work in the following applications:

ARSJ Conjugated Antibody

C45775 100ul
EUR 397

Anti-ARSJ antibody

STJ190565 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ARSJ

ARSJ siRNA

20-abx908241
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARSJ siRNA

20-abx908242
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Rabbit Arylsulfatase J(ARSJ) ELISA kit

E04A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase J(ARSJ) ELISA kit

E04A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Arylsulfatase J(ARSJ) ELISA kit

E04A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Arylsulfatase J (ARSJ) Antibody

abx145195-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Arylsulfatase J (ARSJ) Antibody

20-abx148359
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ARSJ Blocking Peptide

DF9229-BP 1mg
EUR 195

ARSJ cloning plasmid

CSB-CL682915HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 258
  • Sequence: atggctcctgggcagcaggctatgggatctggaacactgcaatccagtcagccatcagagtgcagcactggaaattgcttacaggaaatcctggctacagcgactgggtcccccctcagtctttcagcaacctgggaccgaaccggtggcacaatgaacggatcaccttgtcaact
  • Show more
Description: A cloning plasmid for the ARSJ gene.

ARSJ cloning plasmid

CSB-CL682915HU2-10ug 10ug
EUR 614
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1800
  • Sequence: atggctcccaggggctgtgcggggcatccgcctccgccttctccacaggcctgtgtctgtcctggaaagatgctagcaatgggggcgctggcaggattctggatcctctgcctcctcacttatggttacctgtcctggggccaggccttagaagaggaggaagaaggggccttac
  • Show more
Description: A cloning plasmid for the ARSJ gene.

Mouse ARSJ shRNA Plasmid

20-abx983138
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ARSJ shRNA Plasmid

20-abx962448
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ARSJ Recombinant Protein (Human)

RP001981 100 ug Ask for price

ARSJ Recombinant Protein (Human)

RP036754 100 ug Ask for price

ARSJ Recombinant Protein (Mouse)

RP117362 100 ug Ask for price

ARSJ Recombinant Protein (Rat)

RP191069 100 ug Ask for price

Arsj ORF Vector (Rat) (pORF)

ORF063691 1.0 ug DNA
EUR 506

ARSJ ORF Vector (Human) (pORF)

ORF000661 1.0 ug DNA
EUR 95

ARSJ ORF Vector (Human) (pORF)

ORF012252 1.0 ug DNA
EUR 354

Arsj ORF Vector (Mouse) (pORF)

ORF039122 1.0 ug DNA
EUR 506

Human Arylsulfatase J(ARSJ) ELISA kit

E01A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase J(ARSJ) ELISA kit

E01A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase J(ARSJ) ELISA kit

E01A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase J(ARSJ) ELISA kit

E02A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase J(ARSJ) ELISA kit

E02A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Arylsulfatase J(ARSJ) ELISA kit

E02A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase J(ARSJ) ELISA kit

E06A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase J(ARSJ) ELISA kit

E06A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Arylsulfatase J(ARSJ) ELISA kit

E06A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase J(ARSJ) ELISA kit

E03A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase J(ARSJ) ELISA kit

E03A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Arylsulfatase J(ARSJ) ELISA kit

E03A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase J(ARSJ) ELISA kit

E07A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase J(ARSJ) ELISA kit

E07A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Arylsulfatase J(ARSJ) ELISA kit

E07A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase J(ARSJ) ELISA kit

E08A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase J(ARSJ) ELISA kit

E08A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Arylsulfatase J(ARSJ) ELISA kit

E08A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase J(ARSJ) ELISA kit

E09A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase J(ARSJ) ELISA kit

E09A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Arylsulfatase J(ARSJ) ELISA kit

E09A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Arylsulfatase J, ARSJ ELISA KIT

ELI-11761h 96 Tests
EUR 824

Arsj sgRNA CRISPR Lentivector set (Rat)

K6223501 3 x 1.0 ug
EUR 339

Mouse Arylsulfatase J, Arsj ELISA KIT

ELI-34375m 96 Tests
EUR 865

ARSJ sgRNA CRISPR Lentivector set (Human)

K0128801 3 x 1.0 ug
EUR 339

Arsj sgRNA CRISPR Lentivector set (Mouse)

K3588801 3 x 1.0 ug
EUR 339

Human Arylsulfatase J(ARSJ)ELISA Kit

QY-E03641 96T
EUR 361

Guinea pig Arylsulfatase J(ARSJ) ELISA kit

E05A1691-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Arylsulfatase J(ARSJ) ELISA kit

E05A1691-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Arylsulfatase J(ARSJ) ELISA kit

E05A1691-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Arylsulfatase J(ARSJ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Arsj sgRNA CRISPR Lentivector (Rat) (Target 1)

K6223502 1.0 ug DNA
EUR 154

Arsj sgRNA CRISPR Lentivector (Rat) (Target 2)

K6223503 1.0 ug DNA
EUR 154

Arsj sgRNA CRISPR Lentivector (Rat) (Target 3)

K6223504 1.0 ug DNA
EUR 154

ARSJ sgRNA CRISPR Lentivector (Human) (Target 1)

K0128802 1.0 ug DNA
EUR 154

ARSJ sgRNA CRISPR Lentivector (Human) (Target 2)

K0128803 1.0 ug DNA
EUR 154

ARSJ sgRNA CRISPR Lentivector (Human) (Target 3)

K0128804 1.0 ug DNA
EUR 154

Arsj sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3588802 1.0 ug DNA
EUR 154

Arsj sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3588803 1.0 ug DNA
EUR 154

Arsj sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3588804 1.0 ug DNA
EUR 154

ARSJ Protein Vector (Mouse) (pPB-C-His)

PV156486 500 ng
EUR 603

ARSJ Protein Vector (Mouse) (pPB-N-His)

PV156487 500 ng
EUR 603

ARSJ Protein Vector (Mouse) (pPM-C-HA)

PV156488 500 ng
EUR 603

ARSJ Protein Vector (Mouse) (pPM-C-His)

PV156489 500 ng
EUR 603

ARSJ Protein Vector (Rat) (pPB-C-His)

PV254762 500 ng
EUR 603

ARSJ Protein Vector (Rat) (pPB-N-His)

PV254763 500 ng
EUR 603

ARSJ Protein Vector (Rat) (pPM-C-HA)

PV254764 500 ng
EUR 603

ARSJ Protein Vector (Rat) (pPM-C-His)

PV254765 500 ng
EUR 603

ARSJ Protein Vector (Human) (pPB-His-MBP)

PV324058 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPB-His-GST)

PV324059 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPB-His-MBP)

PV324062 500 ng
EUR 481

ARSJ Protein Vector (Human) (pPB-His-GST)

PV324063 500 ng
EUR 481

ARSJ Protein Vector (Human) (pPB-C-His)

PV002641 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPB-N-His)

PV002642 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPM-C-HA)

PV002643 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPM-C-His)

PV002644 500 ng
EUR 329

ARSJ Protein Vector (Human) (pPB-C-His)

PV049005 500 ng
EUR 481

ARSJ Protein Vector (Human) (pPB-N-His)

PV049006 500 ng
EUR 481

ARSJ Protein Vector (Human) (pPM-C-HA)

PV049007 500 ng
EUR 481

ARSJ Protein Vector (Human) (pPM-C-His)

PV049008 500 ng
EUR 481

Arsj 3'UTR GFP Stable Cell Line

TU152167 1.0 ml Ask for price

ARSJ Rabbit Polyclonal Antibody