BAAT Rabbit Polyclonal Antibody
BAAT Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
BAAT Polyclonal Antibody |
ES9452-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against BAAT from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BAAT Rabbit pAb |
A7646-100ul |
Abclonal |
100 ul |
EUR 308 |
BAAT Rabbit pAb |
A7646-200ul |
Abclonal |
200 ul |
EUR 459 |
BAAT Rabbit pAb |
A7646-20ul |
Abclonal |
20 ul |
EUR 183 |
BAAT Rabbit pAb |
A7646-50ul |
Abclonal |
50 ul |
EUR 223 |
BAAT antibody |
70R-2871 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal BAAT antibody raised against the N terminal of BAAT |
BAAT antibody |
70R-15952 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal BAAT antibody |
BAAT Antibody |
36274-100ul |
SAB |
100ul |
EUR 252 |
BAAT Antibody |
1-CSB-PA002523GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
BAAT Antibody |
1-CSB-PA613484ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
BAAT Antibody |
1-CSB-PA613484LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
BAAT Antibody |
1-CSB-PA907155 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
BAAT Antibody |
DF9277 |
Affbiotech |
200ul |
EUR 304 |
Description: BAAT Antibody detects endogenous levels of total BAAT. |
BAAT Antibody |
1-CSB-PA194965 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100 |
Polyclonal BAAT Antibody (N-Term) |
APG02158G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT (N-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal BAAT Antibody (N-Term) |
APG02159G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT (N-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal BAAT antibody - N-terminal region |
APG02160G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT - N-terminal region. This antibody is tested and proven to work in the following applications: |
BAAT Conjugated Antibody |
C36274 |
SAB |
100ul |
EUR 397 |
anti- BAAT antibody |
FNab00780 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: bile acid Coenzyme A: amino acid N-acyltransferase(glycine N-choloyltransferase)
- Uniprot ID: Q14032
- Gene ID: 570
- Research Area: Metabolism
|
Description: Antibody raised against BAAT |
Anti-BAAT antibody |
STJ29960 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene. |
Anti-BAAT antibody |
STJ190610 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BAAT |
BAAT siRNA |
20-abx900580 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAAT siRNA |
20-abx908822 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BAAT siRNA |
20-abx908823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-BAAT |
YF-PA23281 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to BAAT |
BAAT Antibody, HRP conjugated |
1-CSB-PA613484LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
BAAT Antibody, FITC conjugated |
1-CSB-PA613484LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
BAAT Antibody, Biotin conjugated |
1-CSB-PA613484LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
BAAT Blocking Peptide |
33R-4118 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BAAT antibody, catalog no. 70R-2871 |
BAAT Blocking Peptide |
DF9277-BP |
Affbiotech |
1mg |
EUR 195 |
BAAT cloning plasmid |
CSB-CL613484HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1257
- Sequence: atgatccagttgacagctacccctgtgagtgcacttgttgatgagccagtgcatatccaagctacaggcctgattccctttcagatggtgagttttcaggcatcactggaagatgaaaacggagacatgttttattctcaagcccactatagggccaatgaattcggtgaggtgg
- Show more
|
Description: A cloning plasmid for the BAAT gene. |
Anti-BAAT (5B6) |
YF-MA12096 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BAAT |
Anti-BAAT (1E4) |
YF-MA12097 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to BAAT |
Rat BAAT shRNA Plasmid |
20-abx985695 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse BAAT shRNA Plasmid |
20-abx969310 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BAAT shRNA Plasmid |
20-abx950388 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BAAT Recombinant Protein (Human) |
RP002569 |
ABM |
100 ug |
Ask for price |
BAAT Recombinant Protein (Mouse) |
RP118613 |
ABM |
100 ug |
Ask for price |
BAAT Recombinant Protein (Rat) |
RP191798 |
ABM |
100 ug |
Ask for price |
Monoclonal BAAT Antibody (monoclonal) (M02), Clone: 5B6 |
APG02157G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human BAAT (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5B6. This antibody is applicable in WB, E |
Baat ORF Vector (Rat) (pORF) |
ORF063934 |
ABM |
1.0 ug DNA |
EUR 506 |
BAAT ORF Vector (Human) (pORF) |
ORF000857 |
ABM |
1.0 ug DNA |
EUR 95 |
Baat ORF Vector (Mouse) (pORF) |
ORF039539 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit |
E04B0733-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit |
E04B0733-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit |
E04B0733-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx006496 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx211125 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx213156 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx111225 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
abx145197-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx322487 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx302144 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
20-abx225056 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody |
abx230780-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Baat sgRNA CRISPR Lentivector set (Rat) |
K7570701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Baat sgRNA CRISPR Lentivector set (Mouse) |
K3375001 |
ABM |
3 x 1.0 ug |
EUR 339 |
BAAT sgRNA CRISPR Lentivector set (Human) |
K0166101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (HRP) |
20-abx314482 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (FITC) |
20-abx314483 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (Biotin) |
20-abx314484 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Baat sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7570702 |
ABM |
1.0 ug DNA |
EUR 154 |
Baat sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7570703 |
ABM |
1.0 ug DNA |
EUR 154 |
Baat sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7570704 |
ABM |
1.0 ug DNA |
EUR 154 |
Baat sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3375002 |
ABM |
1.0 ug DNA |
EUR 154 |
Baat sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3375003 |
ABM |
1.0 ug DNA |
EUR 154 |
Baat sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3375004 |
ABM |
1.0 ug DNA |
EUR 154 |
BAAT sgRNA CRISPR Lentivector (Human) (Target 1) |
K0166102 |
ABM |
1.0 ug DNA |
EUR 154 |
BAAT sgRNA CRISPR Lentivector (Human) (Target 2) |
K0166103 |
ABM |
1.0 ug DNA |
EUR 154 |
BAAT sgRNA CRISPR Lentivector (Human) (Target 3) |
K0166104 |
ABM |
1.0 ug DNA |
EUR 154 |
BAAT Protein Vector (Mouse) (pPB-C-His) |
PV158154 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Mouse) (pPB-N-His) |
PV158155 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Mouse) (pPM-C-HA) |
PV158156 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Mouse) (pPM-C-His) |
PV158157 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Rat) (pPB-C-His) |
PV255734 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Rat) (pPB-N-His) |
PV255735 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Rat) (pPM-C-HA) |
PV255736 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Rat) (pPM-C-His) |
PV255737 |
ABM |
500 ng |
EUR 603 |
BAAT Protein Vector (Human) (pPB-His-MBP) |
PV326062 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPB-His-GST) |
PV326063 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPB-His-MBP) |
PV326066 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPB-His-GST) |
PV326067 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPB-C-His) |
PV003425 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPB-N-His) |
PV003426 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPM-C-HA) |
PV003427 |
ABM |
500 ng |
EUR 329 |
BAAT Protein Vector (Human) (pPM-C-His) |
PV003428 |
ABM |
500 ng |
EUR 329 |
Baat 3'UTR GFP Stable Cell Line |
TU152498 |
ABM |
1.0 ml |
Ask for price |
Baat 3'UTR Luciferase Stable Cell Line |
TU102498 |
ABM |
1.0 ml |
Ask for price |
Baat 3'UTR Luciferase Stable Cell Line |
TU201200 |
ABM |
1.0 ml |
Ask for price |
Baat 3'UTR GFP Stable Cell Line |
TU251200 |
ABM |
1.0 ml |
Ask for price |
BAAT 3'UTR GFP Stable Cell Line |
TU051600 |
ABM |
1.0 ml |
EUR 1521 |
BAAT 3'UTR Luciferase Stable Cell Line |
TU001600 |
ABM |
1.0 ml |
EUR 1521 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
BAAT Rabbit Polyclonal Antibody