BAAT Rabbit Polyclonal Antibody

BAAT Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

BAAT Polyclonal Antibody

ES9452-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BAAT from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

BAAT Rabbit pAb

A7646-100ul 100 ul
EUR 308

BAAT Rabbit pAb

A7646-200ul 200 ul
EUR 459

BAAT Rabbit pAb

A7646-20ul 20 ul
EUR 183

BAAT Rabbit pAb

A7646-50ul 50 ul
EUR 223

BAAT antibody

70R-2871 50 ug
EUR 467
Description: Rabbit polyclonal BAAT antibody raised against the N terminal of BAAT

BAAT antibody

70R-15952 50 ul
EUR 435
Description: Rabbit polyclonal BAAT antibody

BAAT Antibody

36274-100ul 100ul
EUR 252

BAAT Antibody

1-CSB-PA002523GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

BAAT Antibody

1-CSB-PA613484ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BAAT Antibody

1-CSB-PA613484LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

BAAT Antibody

1-CSB-PA907155
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BAAT Antibody

DF9277 200ul
EUR 304
Description: BAAT Antibody detects endogenous levels of total BAAT.

BAAT Antibody

1-CSB-PA194965
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BAAT Antibody

ABD9277 100 ug
EUR 438

Polyclonal BAAT Antibody (N-Term)

APG02158G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal BAAT Antibody (N-Term)

APG02159G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT (N-Term). This antibody is tested and proven to work in the following applications:

Polyclonal BAAT antibody - N-terminal region

APG02160G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BAAT - N-terminal region. This antibody is tested and proven to work in the following applications:

BAAT Conjugated Antibody

C36274 100ul
EUR 397

anti- BAAT antibody

FNab00780 100µg
EUR 505.25
  • Immunogen: bile acid Coenzyme A: amino acid N-acyltransferase(glycine N-choloyltransferase)
  • Uniprot ID: Q14032
  • Gene ID: 570
  • Research Area: Metabolism
Description: Antibody raised against BAAT

Anti-BAAT antibody

PAab00780 100 ug
EUR 355

Anti-BAAT antibody

STJ29960 100 µl
EUR 277
Description: The protein encoded by this gene is a liver enzyme that catalyzes the transfer of C24 bile acids from the acyl-CoA thioester to either glycine or taurine, the second step in the formation of bile acid-amino acid conjugates. The bile acid conjugates then act as a detergent in the gastrointestinal tract, which enhances lipid and fat-soluble vitamin absorption. Defects in this gene are a cause of familial hypercholanemia (FHCA). Two transcript variants encoding the same protein have been found for this gene.

Anti-BAAT antibody

STJ190610 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BAAT

Baat/ Rat Baat ELISA Kit

ELI-11479r 96 Tests
EUR 886

BAAT siRNA

20-abx900580
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BAAT siRNA

20-abx908822
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BAAT siRNA

20-abx908823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-BAAT

YF-PA23281 50 ul
EUR 334
Description: Mouse polyclonal to BAAT

BAAT Antibody, HRP conjugated

1-CSB-PA613484LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BAAT Antibody, FITC conjugated

1-CSB-PA613484LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BAAT Antibody, Biotin conjugated

1-CSB-PA613484LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BAAT. Recognizes BAAT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BAAT Blocking Peptide

33R-4118 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BAAT antibody, catalog no. 70R-2871

BAAT Blocking Peptide

DF9277-BP 1mg
EUR 195

BAAT cloning plasmid

CSB-CL613484HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1257
  • Sequence: atgatccagttgacagctacccctgtgagtgcacttgttgatgagccagtgcatatccaagctacaggcctgattccctttcagatggtgagttttcaggcatcactggaagatgaaaacggagacatgttttattctcaagcccactatagggccaatgaattcggtgaggtgg
  • Show more
Description: A cloning plasmid for the BAAT gene.

Anti-BAAT (5B6)

YF-MA12096 100 ug
EUR 363
Description: Mouse monoclonal to BAAT

Anti-BAAT (1E4)

YF-MA12097 100 ug
EUR 363
Description: Mouse monoclonal to BAAT

BAAT ELISA KIT|Human

EF008049 96 Tests
EUR 689

Rat BAAT shRNA Plasmid

20-abx985695
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BAAT shRNA Plasmid

20-abx969310
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BAAT shRNA Plasmid

20-abx950388
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BAAT ELISA KIT

ELI-48934h 96 Tests
EUR 824

Mouse Baat ELISA KIT

ELI-48935m 96 Tests
EUR 865

BAAT Recombinant Protein (Human)

RP002569 100 ug Ask for price

BAAT Recombinant Protein (Mouse)

RP118613 100 ug Ask for price

BAAT Recombinant Protein (Rat)

RP191798 100 ug Ask for price

Monoclonal BAAT Antibody (monoclonal) (M02), Clone: 5B6

APG02157G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BAAT (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5B6. This antibody is applicable in WB, E

Baat ORF Vector (Rat) (pORF)

ORF063934 1.0 ug DNA
EUR 506

BAAT ORF Vector (Human) (pORF)

ORF000857 1.0 ug DNA
EUR 95

Baat ORF Vector (Mouse) (pORF)

ORF039539 1.0 ug DNA
EUR 506

Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit

E04B0733-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit

E04B0733-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) ELISA kit

E04B0733-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bile acid CoA:amino acid N acyltransferase(BAAT) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx006496
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx211125
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx213156
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx111225
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

abx145197-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx322487
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx302144
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

20-abx225056
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody

abx230780-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Baat sgRNA CRISPR Lentivector set (Rat)

K7570701 3 x 1.0 ug
EUR 339

Baat sgRNA CRISPR Lentivector set (Mouse)

K3375001 3 x 1.0 ug
EUR 339

BAAT sgRNA CRISPR Lentivector set (Human)

K0166101 3 x 1.0 ug
EUR 339

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (HRP)

20-abx314482
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (FITC)

20-abx314483
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Bile Acid-CoA:amino Acid N-Acyltransferase (BAAT) Antibody (Biotin)

20-abx314484
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Baat sgRNA CRISPR Lentivector (Rat) (Target 1)

K7570702 1.0 ug DNA
EUR 154

Baat sgRNA CRISPR Lentivector (Rat) (Target 2)

K7570703 1.0 ug DNA
EUR 154

Baat sgRNA CRISPR Lentivector (Rat) (Target 3)

K7570704 1.0 ug DNA
EUR 154

Baat sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3375002 1.0 ug DNA
EUR 154

Baat sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3375003 1.0 ug DNA
EUR 154

Baat sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3375004 1.0 ug DNA
EUR 154

BAAT sgRNA CRISPR Lentivector (Human) (Target 1)

K0166102 1.0 ug DNA
EUR 154

BAAT sgRNA CRISPR Lentivector (Human) (Target 2)

K0166103 1.0 ug DNA
EUR 154

BAAT sgRNA CRISPR Lentivector (Human) (Target 3)

K0166104 1.0 ug DNA
EUR 154

BAAT Protein Vector (Mouse) (pPB-C-His)

PV158154 500 ng
EUR 603

BAAT Protein Vector (Mouse) (pPB-N-His)

PV158155 500 ng
EUR 603

BAAT Protein Vector (Mouse) (pPM-C-HA)

PV158156 500 ng
EUR 603

BAAT Protein Vector (Mouse) (pPM-C-His)

PV158157 500 ng
EUR 603

BAAT Protein Vector (Rat) (pPB-C-His)

PV255734 500 ng
EUR 603

BAAT Protein Vector (Rat) (pPB-N-His)

PV255735 500 ng
EUR 603

BAAT Protein Vector (Rat) (pPM-C-HA)

PV255736 500 ng
EUR 603

BAAT Protein Vector (Rat) (pPM-C-His)

PV255737 500 ng
EUR 603

BAAT Protein Vector (Human) (pPB-His-MBP)

PV326062 500 ng
EUR 329

BAAT Protein Vector (Human) (pPB-His-GST)

PV326063 500 ng
EUR 329

BAAT Protein Vector (Human) (pPB-His-MBP)

PV326066 500 ng
EUR 329

BAAT Protein Vector (Human) (pPB-His-GST)

PV326067 500 ng
EUR 329

BAAT Protein Vector (Human) (pPB-C-His)

PV003425 500 ng
EUR 329

BAAT Protein Vector (Human) (pPB-N-His)

PV003426 500 ng
EUR 329

BAAT Protein Vector (Human) (pPM-C-HA)

PV003427 500 ng
EUR 329

BAAT Protein Vector (Human) (pPM-C-His)

PV003428 500 ng
EUR 329

Baat 3'UTR GFP Stable Cell Line

TU152498 1.0 ml Ask for price

Baat 3'UTR Luciferase Stable Cell Line

TU102498 1.0 ml Ask for price

Baat 3'UTR Luciferase Stable Cell Line

TU201200 1.0 ml Ask for price

Baat 3'UTR GFP Stable Cell Line

TU251200 1.0 ml Ask for price

BAAT 3'UTR GFP Stable Cell Line

TU051600 1.0 ml
EUR 1521

BAAT 3'UTR Luciferase Stable Cell Line

TU001600 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

BAAT Rabbit Polyclonal Antibody