BATF2 Rabbit Polyclonal Antibody
BATF2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
BATF2 Polyclonal Antibody |
ES9441-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against BATF2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
BATF2 Polyclonal Antibody |
ABP57889-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260 |
BATF2 Polyclonal Antibody |
ABP57889-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260 |
BATF2 Polyclonal Antibody |
ABP57889-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
- Applications tips:
|
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260 |
BATF2 Polyclonal Antibody |
A66342 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
BATF2 antibody |
70R-51163 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal BATF2 antibody |
BATF2 antibody |
70R-8758 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal BATF2 antibody |
BATF2 antibody |
70R-8759 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal BATF2 antibody |
BATF2 Antibody |
45800-100ul |
SAB |
100ul |
EUR 252 |
BATF2 Antibody |
45800-50ul |
SAB |
50ul |
EUR 187 |
BATF2 Antibody |
DF9266 |
Affbiotech |
200ul |
EUR 304 |
Description: BATF2 Antibody detects endogenous levels of total BATF2. |
BATF2 Antibody |
1-CSB-PA822685LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
BATF2 Polyclonal Antibody, HRP Conjugated |
A66343 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
BATF2 Polyclonal Antibody, FITC Conjugated |
A66344 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
BATF2 Polyclonal Antibody, Biotin Conjugated |
A66345 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
BATF2 Conjugated Antibody |
C45800 |
SAB |
100ul |
EUR 397 |
anti- BATF2 antibody |
FNab00808 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: basic leucine zipper transcription factor, ATF-like 2
- Uniprot ID: Q8N1L9
- Gene ID: 116071
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against BATF2 |
Anti-BATF2 antibody |
STJ190599 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to BATF2 |
BATF2 siRNA |
20-abx908895 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BATF2 siRNA |
20-abx908896 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BATF2 Antibody, HRP conjugated |
1-CSB-PA822685LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
BATF2 Antibody, FITC conjugated |
1-CSB-PA822685LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
BATF2 Antibody, Biotin conjugated |
1-CSB-PA822685LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
BATF2 Blocking Peptide |
20-abx064038 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
BATF2 Blocking Peptide |
33R-6095 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BATF2 antibody, catalog no. 70R-8759 |
BATF2 Blocking Peptide |
33R-1457 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BATF2 antibody, catalog no. 70R-8758 |
BATF2 Blocking Peptide |
DF9266-BP |
Affbiotech |
1mg |
EUR 195 |
BATF2 cloning plasmid |
CSB-CL822685HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 570
- Sequence: atggattgtgcctcctgctcagctccagggctcctgggctgctgggaccaggctgaggggctcctgggccctggcccacagggacaacatggctgccgggagcagctggagctgttccagaccccgggttcctgttacccagctcagccgctctctccaggtccacagcctcatga
- Show more
|
Description: A cloning plasmid for the BATF2 gene. |
Mouse BATF2 shRNA Plasmid |
20-abx978245 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human BATF2 shRNA Plasmid |
20-abx964481 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
BATF2 Recombinant Protein (Human) |
RP002647 |
ABM |
100 ug |
Ask for price |
BATF2 Recombinant Protein (Mouse) |
RP118757 |
ABM |
100 ug |
Ask for price |
BATF2 ORF Vector (Human) (pORF) |
ORF000883 |
ABM |
1.0 ug DNA |
EUR 95 |
Batf2 ORF Vector (Mouse) (pORF) |
ORF039587 |
ABM |
1.0 ug DNA |
EUR 506 |
BATF2 sgRNA CRISPR Lentivector set (Human) |
K0171101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Batf2 sgRNA CRISPR Lentivector set (Mouse) |
K3738401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit |
E04B0751-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit |
E04B0751-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit |
E04B0751-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
BATF2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0171102 |
ABM |
1.0 ug DNA |
EUR 154 |
BATF2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0171103 |
ABM |
1.0 ug DNA |
EUR 154 |
BATF2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0171104 |
ABM |
1.0 ug DNA |
EUR 154 |
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3738402 |
ABM |
1.0 ug DNA |
EUR 154 |
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3738403 |
ABM |
1.0 ug DNA |
EUR 154 |
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3738404 |
ABM |
1.0 ug DNA |
EUR 154 |
BATF2 Protein Vector (Human) (pPB-C-His) |
PV003529 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Human) (pPB-N-His) |
PV003530 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Human) (pPM-C-HA) |
PV003531 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Human) (pPM-C-His) |
PV003532 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Human) (pPB-His-MBP) |
PV326294 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Human) (pPB-His-GST) |
PV326295 |
ABM |
500 ng |
EUR 329 |
BATF2 Protein Vector (Mouse) (pPB-C-His) |
PV158346 |
ABM |
500 ng |
EUR 603 |
BATF2 Protein Vector (Mouse) (pPB-N-His) |
PV158347 |
ABM |
500 ng |
EUR 603 |
BATF2 Protein Vector (Mouse) (pPM-C-HA) |
PV158348 |
ABM |
500 ng |
EUR 603 |
BATF2 Protein Vector (Mouse) (pPM-C-His) |
PV158349 |
ABM |
500 ng |
EUR 603 |
Batf2 3'UTR Luciferase Stable Cell Line |
TU201233 |
ABM |
1.0 ml |
Ask for price |
Batf2 3'UTR GFP Stable Cell Line |
TU152534 |
ABM |
1.0 ml |
Ask for price |
BATF2 3'UTR Luciferase Stable Cell Line |
TU001654 |
ABM |
1.0 ml |
EUR 1394 |
Batf2 3'UTR Luciferase Stable Cell Line |
TU102534 |
ABM |
1.0 ml |
Ask for price |
BATF2 3'UTR GFP Stable Cell Line |
TU051654 |
ABM |
1.0 ml |
EUR 1394 |
Batf2 3'UTR GFP Stable Cell Line |
TU251233 |
ABM |
1.0 ml |
Ask for price |
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody |
20-abx148546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody |
20-abx007977 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody |
20-abx301518 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody |
abx230808-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (HRP) |
20-abx308956 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (FITC) |
20-abx308957 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (Biotin) |
20-abx308958 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
BATF2 Rabbit Polyclonal Antibody