BATF2 Rabbit Polyclonal Antibody

BATF2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

BATF2 Polyclonal Antibody
ES9441-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BATF2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
BATF2 Polyclonal Antibody
ABP57889-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
BATF2 Polyclonal Antibody
ABP57889-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
BATF2 Polyclonal Antibody
ABP57889-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
  • Applications tips:
Description: A polyclonal antibody for detection of BATF2 from Human. This BATF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BATF2 protein at amino acid sequence of 180-260
BATF2 Polyclonal Antibody
A66342 100 µg
EUR 570.55
Description: fast delivery possible
BATF2 Antibody
ABD9266 100 ug
EUR 438
BATF2 antibody
70R-51163 100 ul
EUR 244
Description: Purified Polyclonal BATF2 antibody
BATF2 antibody
70R-8758 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal BATF2 antibody
BATF2 antibody
70R-8759 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal BATF2 antibody
BATF2 Antibody
45800-100ul 100ul
EUR 252
BATF2 Antibody
45800-50ul 50ul
EUR 187
BATF2 Antibody
DF9266 200ul
EUR 304
Description: BATF2 Antibody detects endogenous levels of total BATF2.
BATF2 Antibody
1-CSB-PA822685LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
BATF2 Polyclonal Antibody, HRP Conjugated
A66343 100 µg
EUR 570.55
Description: reagents widely cited
BATF2 Polyclonal Antibody, FITC Conjugated
A66344 100 µg
EUR 570.55
Description: Ask the seller for details
BATF2 Polyclonal Antibody, Biotin Conjugated
A66345 100 µg
EUR 570.55
Description: The best epigenetics products
BATF2 Conjugated Antibody
C45800 100ul
EUR 397
anti- BATF2 antibody
FNab00808 100µg
EUR 505.25
  • Immunogen: basic leucine zipper transcription factor, ATF-like 2
  • Uniprot ID: Q8N1L9
  • Gene ID: 116071
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against BATF2
Anti-BATF2 antibody
PAab00808 100 ug
EUR 355
Anti-BATF2 antibody
STJ190599 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to BATF2
BATF2 siRNA
20-abx908895
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BATF2 siRNA
20-abx908896
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
BATF2 Antibody, HRP conjugated
1-CSB-PA822685LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
BATF2 Antibody, FITC conjugated
1-CSB-PA822685LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
BATF2 Antibody, Biotin conjugated
1-CSB-PA822685LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BATF2. Recognizes BATF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
BATF2 Blocking Peptide
20-abx064038
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
BATF2 Blocking Peptide
33R-6095 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BATF2 antibody, catalog no. 70R-8759
BATF2 Blocking Peptide
33R-1457 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BATF2 antibody, catalog no. 70R-8758
BATF2 Blocking Peptide
DF9266-BP 1mg
EUR 195
BATF2 cloning plasmid
CSB-CL822685HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 570
  • Sequence: atggattgtgcctcctgctcagctccagggctcctgggctgctgggaccaggctgaggggctcctgggccctggcccacagggacaacatggctgccgggagcagctggagctgttccagaccccgggttcctgttacccagctcagccgctctctccaggtccacagcctcatga
  • Show more
Description: A cloning plasmid for the BATF2 gene.
Mouse BATF2 shRNA Plasmid
20-abx978245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human BATF2 shRNA Plasmid
20-abx964481
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Batf2 ELISA KIT
ELI-24475m 96 Tests
EUR 865
BATF2 ELISA KIT|Human
EF008068 96 Tests
EUR 689
Human BATF2 ELISA KIT
ELI-50006h 96 Tests
EUR 824
BATF2 Recombinant Protein (Human)
RP002647 100 ug Ask for price
BATF2 Recombinant Protein (Mouse)
RP118757 100 ug Ask for price
BATF2 ORF Vector (Human) (pORF)
ORF000883 1.0 ug DNA
EUR 95
Batf2 ORF Vector (Mouse) (pORF)
ORF039587 1.0 ug DNA
EUR 506
BATF2 sgRNA CRISPR Lentivector set (Human)
K0171101 3 x 1.0 ug
EUR 339
Batf2 sgRNA CRISPR Lentivector set (Mouse)
K3738401 3 x 1.0 ug
EUR 339
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit
E04B0751-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit
E04B0751-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) ELISA kit
E04B0751-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Basic leucine zipper transcriptional factor ATF like 2(BATF2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
BATF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0171102 1.0 ug DNA
EUR 154
BATF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0171103 1.0 ug DNA
EUR 154
BATF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0171104 1.0 ug DNA
EUR 154
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3738402 1.0 ug DNA
EUR 154
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3738403 1.0 ug DNA
EUR 154
Batf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3738404 1.0 ug DNA
EUR 154
BATF2 Protein Vector (Human) (pPB-C-His)
PV003529 500 ng
EUR 329
BATF2 Protein Vector (Human) (pPB-N-His)
PV003530 500 ng
EUR 329
BATF2 Protein Vector (Human) (pPM-C-HA)
PV003531 500 ng
EUR 329
BATF2 Protein Vector (Human) (pPM-C-His)
PV003532 500 ng
EUR 329
BATF2 Protein Vector (Human) (pPB-His-MBP)
PV326294 500 ng
EUR 329
BATF2 Protein Vector (Human) (pPB-His-GST)
PV326295 500 ng
EUR 329
BATF2 Protein Vector (Mouse) (pPB-C-His)
PV158346 500 ng
EUR 603
BATF2 Protein Vector (Mouse) (pPB-N-His)
PV158347 500 ng
EUR 603
BATF2 Protein Vector (Mouse) (pPM-C-HA)
PV158348 500 ng
EUR 603
BATF2 Protein Vector (Mouse) (pPM-C-His)
PV158349 500 ng
EUR 603
Batf2 3'UTR Luciferase Stable Cell Line
TU201233 1.0 ml Ask for price
Batf2 3'UTR GFP Stable Cell Line
TU152534 1.0 ml Ask for price
BATF2 3'UTR Luciferase Stable Cell Line
TU001654 1.0 ml
EUR 1394
Batf2 3'UTR Luciferase Stable Cell Line
TU102534 1.0 ml Ask for price
BATF2 3'UTR GFP Stable Cell Line
TU051654 1.0 ml
EUR 1394
Batf2 3'UTR GFP Stable Cell Line
TU251233 1.0 ml Ask for price
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody
20-abx148546
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody
20-abx007977
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody
20-abx301518
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody
abx230808-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (HRP)
20-abx308956
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (FITC)
20-abx308957
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Basic Leucine Zipper Transcription Factor, ATF-Like 2 (BATF2) Antibody (Biotin)
20-abx308958
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

BATF2 Rabbit Polyclonal Antibody