CABYR Rabbit Polyclonal Antibody

CABYR Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CABYR Polyclonal Antibody

ES9475-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CABYR Polyclonal Antibody

ABP57952-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CABYR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein

CABYR Polyclonal Antibody

ABP57952-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CABYR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein

CABYR Polyclonal Antibody

ABP57952-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CABYR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein

CABYR Antibody

ABD9310 100 ug
EUR 438

CABYR Antibody

ABD13032 100 ug
EUR 438

CABYR Antibody

45830-100ul 100ul
EUR 252

CABYR Antibody

45830-50ul 50ul
EUR 187

CABYR antibody

70R-16116 50 ul
EUR 435
Description: Rabbit polyclonal CABYR antibody

CABYR Antibody

DF9310 200ul
EUR 304
Description: CABYR Antibody detects endogenous levels of total CABYR.

CABYR Antibody

1-CSB-PA004393GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CABYR. Recognizes CABYR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CABYR Conjugated Antibody

C45830 100ul
EUR 397

anti- CABYR antibody

FNab01170 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: calcium binding tyrosine-(Y)-phosphorylation regulated
  • Uniprot ID: O75952
  • Gene ID: 26256
  • Research Area: Signal Transduction
Description: Antibody raised against CABYR

Anti-CABYR antibody

PAab01170 100 ug
EUR 386

Anti-CABYR antibody

STJ190633 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CABYR

CABYR siRNA

20-abx910054
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CABYR siRNA

20-abx910055
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CABYR

YF-PA18264 50 ug
EUR 363
Description: Mouse polyclonal to CABYR

CABYR cloning plasmid

CSB-CL004393HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1140
  • Sequence: atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctgg
  • Show more
Description: A cloning plasmid for the CABYR gene.

CABYR Blocking Peptide

DF9310-BP 1mg
EUR 195

Recombinant Human CABYR

P0559 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: O75952
Description: Recombinant Human protein for CABYR

pCMV-SPORT6-CABYR

PVT13645 2 ug
EUR 391

Mouse CABYR shRNA Plasmid

20-abx977359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CABYR ELISA KIT

ELI-10860h 96 Tests
EUR 824

Mouse Cabyr ELISA KIT

ELI-11117m 96 Tests
EUR 865

CABYR ELISA KIT|Human

EF008319 96 Tests
EUR 689

Human CABYR shRNA Plasmid

20-abx958781
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CABYR Recombinant Protein (Human)

RP005416 100 ug Ask for price

CABYR Recombinant Protein (Rat)

RP192764 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120530 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120533 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120536 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120539 100 ug Ask for price

CABYR Recombinant Protein (Mouse)

RP120542 100 ug Ask for price

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx036854-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx029847-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

abx029847-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody

20-abx318381
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CABYR ORF Vector (Human) (pORF)

ORF001806 1.0 ug DNA
EUR 95

Cabyr ORF Vector (Mouse) (pORF)

ORF040178 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040179 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040180 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040181 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Mouse) (pORF)

ORF040182 1.0 ug DNA
EUR 506

Cabyr ORF Vector (Rat) (pORF)

ORF064256 1.0 ug DNA
EUR 506

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit

E04C1302-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

20-abx111304
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

20-abx148788
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP)

20-abx307471
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC)

20-abx307472
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin)

20-abx307473
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

abx340188-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody

abx231170-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

CABYR sgRNA CRISPR Lentivector set (Human)

K0350201 3 x 1.0 ug
EUR 339

Cabyr sgRNA CRISPR Lentivector set (Mouse)

K4072601 3 x 1.0 ug
EUR 339

Cabyr sgRNA CRISPR Lentivector set (Rat)

K6521601 3 x 1.0 ug
EUR 339

CABYR sgRNA CRISPR Lentivector (Human) (Target 1)

K0350202 1.0 ug DNA
EUR 154

CABYR sgRNA CRISPR Lentivector (Human) (Target 2)

K0350203 1.0 ug DNA
EUR 154

CABYR sgRNA CRISPR Lentivector (Human) (Target 3)

K0350204 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4072602 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4072603 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4072604 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 1)

K6521602 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 2)

K6521603 1.0 ug DNA
EUR 154

Cabyr sgRNA CRISPR Lentivector (Rat) (Target 3)

K6521604 1.0 ug DNA
EUR 154

CABYR Protein Vector (Human) (pPB-C-His)

PV007221 500 ng
EUR 329

CABYR Protein Vector (Human) (pPB-N-His)

PV007222 500 ng
EUR 329

CABYR Protein Vector (Human) (pPM-C-HA)

PV007223 500 ng
EUR 329

CABYR Protein Vector (Human) (pPM-C-His)

PV007224 500 ng
EUR 329

CABYR Protein Vector (Rat) (pPB-C-His)

PV257022 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPB-N-His)

PV257023 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPM-C-HA)

PV257024 500 ng
EUR 603

CABYR Protein Vector (Rat) (pPM-C-His)

PV257025 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160710 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160711 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160712 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160713 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160714 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160715 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160716 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160717 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160718 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160719 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160720 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160721 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160722 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160723 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160724 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160725 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-C-His)

PV160726 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPB-N-His)

PV160727 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-HA)

PV160728 500 ng
EUR 603

CABYR Protein Vector (Mouse) (pPM-C-His)

PV160729 500 ng
EUR 603

Cabyr 3'UTR Luciferase Stable Cell Line

TU201540 1.0 ml Ask for price

Cabyr 3'UTR GFP Stable Cell Line

TU153009 1.0 ml Ask for price

CABYR 3'UTR Luciferase Stable Cell Line

TU003350 1.0 ml
EUR 1394

Cabyr 3'UTR Luciferase Stable Cell Line

TU103009 1.0 ml Ask for price

CABYR 3'UTR GFP Stable Cell Line

TU053350 1.0 ml
EUR 1394

Cabyr 3'UTR GFP Stable Cell Line

TU251540 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CABYR Rabbit Polyclonal Antibody