CABYR Rabbit Polyclonal Antibody
CABYR Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
CABYR Polyclonal Antibody |
ES9475-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CABYR Polyclonal Antibody |
ABP57952-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CABYR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein |
CABYR Polyclonal Antibody |
ABP57952-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CABYR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein |
CABYR Polyclonal Antibody |
ABP57952-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CABYR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein |
CABYR Antibody |
45830-100ul |
SAB |
100ul |
EUR 252 |
CABYR Antibody |
45830-50ul |
SAB |
50ul |
EUR 187 |
CABYR antibody |
70R-16116 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CABYR antibody |
CABYR Antibody |
DF9310 |
Affbiotech |
200ul |
EUR 304 |
Description: CABYR Antibody detects endogenous levels of total CABYR. |
CABYR Antibody |
1-CSB-PA004393GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CABYR. Recognizes CABYR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CABYR Conjugated Antibody |
C45830 |
SAB |
100ul |
EUR 397 |
anti- CABYR antibody |
FNab01170 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: calcium binding tyrosine-(Y)-phosphorylation regulated
- Uniprot ID: O75952
- Gene ID: 26256
- Research Area: Signal Transduction
|
Description: Antibody raised against CABYR |
Anti-CABYR antibody |
STJ190633 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CABYR |
CABYR siRNA |
20-abx910054 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CABYR siRNA |
20-abx910055 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CABYR |
YF-PA18264 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CABYR |
CABYR cloning plasmid |
CSB-CL004393HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1140
- Sequence: atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctgg
- Show more
|
Description: A cloning plasmid for the CABYR gene. |
CABYR Blocking Peptide |
DF9310-BP |
Affbiotech |
1mg |
EUR 195 |
Recombinant Human CABYR |
P0559 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: O75952
|
Description: Recombinant Human protein for CABYR |
Mouse CABYR shRNA Plasmid |
20-abx977359 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CABYR shRNA Plasmid |
20-abx958781 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CABYR Recombinant Protein (Human) |
RP005416 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Rat) |
RP192764 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
RP120530 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
RP120533 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
RP120536 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
RP120539 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
RP120542 |
ABM |
100 ug |
Ask for price |
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
abx036854-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
abx029847-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
abx029847-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
20-abx318381 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CABYR ORF Vector (Human) (pORF) |
ORF001806 |
ABM |
1.0 ug DNA |
EUR 95 |
Cabyr ORF Vector (Mouse) (pORF) |
ORF040178 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
ORF040179 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
ORF040180 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
ORF040181 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
ORF040182 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Rat) (pORF) |
ORF064256 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
E04C1302-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
E04C1302-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
E04C1302-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
20-abx111304 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
20-abx148788 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP) |
20-abx307471 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC) |
20-abx307472 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin) |
20-abx307473 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
abx340188-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
abx231170-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
CABYR sgRNA CRISPR Lentivector set (Human) |
K0350201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cabyr sgRNA CRISPR Lentivector set (Mouse) |
K4072601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cabyr sgRNA CRISPR Lentivector set (Rat) |
K6521601 |
ABM |
3 x 1.0 ug |
EUR 339 |
CABYR sgRNA CRISPR Lentivector (Human) (Target 1) |
K0350202 |
ABM |
1.0 ug DNA |
EUR 154 |
CABYR sgRNA CRISPR Lentivector (Human) (Target 2) |
K0350203 |
ABM |
1.0 ug DNA |
EUR 154 |
CABYR sgRNA CRISPR Lentivector (Human) (Target 3) |
K0350204 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4072602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4072603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4072604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6521602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6521603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cabyr sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6521604 |
ABM |
1.0 ug DNA |
EUR 154 |
CABYR Protein Vector (Human) (pPB-C-His) |
PV007221 |
ABM |
500 ng |
EUR 329 |
CABYR Protein Vector (Human) (pPB-N-His) |
PV007222 |
ABM |
500 ng |
EUR 329 |
CABYR Protein Vector (Human) (pPM-C-HA) |
PV007223 |
ABM |
500 ng |
EUR 329 |
CABYR Protein Vector (Human) (pPM-C-His) |
PV007224 |
ABM |
500 ng |
EUR 329 |
CABYR Protein Vector (Rat) (pPB-C-His) |
PV257022 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Rat) (pPB-N-His) |
PV257023 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Rat) (pPM-C-HA) |
PV257024 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Rat) (pPM-C-His) |
PV257025 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
PV160710 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
PV160711 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
PV160712 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
PV160713 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
PV160714 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
PV160715 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
PV160716 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
PV160717 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
PV160718 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
PV160719 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
PV160720 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
PV160721 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
PV160722 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
PV160723 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
PV160724 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
PV160725 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
PV160726 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
PV160727 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
PV160728 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
PV160729 |
ABM |
500 ng |
EUR 603 |
Cabyr 3'UTR Luciferase Stable Cell Line |
TU201540 |
ABM |
1.0 ml |
Ask for price |
Cabyr 3'UTR GFP Stable Cell Line |
TU153009 |
ABM |
1.0 ml |
Ask for price |
CABYR 3'UTR Luciferase Stable Cell Line |
TU003350 |
ABM |
1.0 ml |
EUR 1394 |
Cabyr 3'UTR Luciferase Stable Cell Line |
TU103009 |
ABM |
1.0 ml |
Ask for price |
CABYR 3'UTR GFP Stable Cell Line |
TU053350 |
ABM |
1.0 ml |
EUR 1394 |
Cabyr 3'UTR GFP Stable Cell Line |
TU251540 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CABYR Rabbit Polyclonal Antibody