CABYR Rabbit Polyclonal Antibody
CABYR Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 CABYR Polyclonal Antibody |
|
ABP57952-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CABYR protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein |
CABYR Polyclonal Antibody |
|
ABP57952-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CABYR protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CABYR from Human. This CABYR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CABYR protein |
CABYR Polyclonal Antibody |
|
ES9475-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CABYR Polyclonal Antibody |
|
ES9475-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CABYR from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 CABYR antibody |
|
70R-16116 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CABYR antibody |
 CABYR Antibody |
|
45830-100ul |
SAB |
100ul |
EUR 252 |
CABYR Antibody |
|
45830-50ul |
SAB |
50ul |
EUR 187 |
CABYR Antibody |
|
1-CSB-PA004393GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CABYR. Recognizes CABYR from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CABYR Antibody |
|
DF9310 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CABYR Antibody detects endogenous levels of total CABYR. |
 CABYR Conjugated Antibody |
|
C45830 |
SAB |
100ul |
EUR 397 |
 anti- CABYR antibody |
|
FNab01170 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:20-1:200
- Immunogen: calcium binding tyrosine-(Y)-phosphorylation regulated
- Uniprot ID: O75952
- Gene ID: 26256
- Research Area: Signal Transduction
|
|
Description: Antibody raised against CABYR |
 Anti-CABYR antibody |
|
STJ190633 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CABYR |
 CABYR siRNA |
|
20-abx910054 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CABYR siRNA |
|
20-abx910055 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-CABYR |
|
YF-PA18264 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to CABYR |
 CABYR Blocking Peptide |
|
DF9310-BP |
Affbiotech |
1mg |
EUR 195 |
 CABYR cloning plasmid |
|
CSB-CL004393HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1140
- Sequence: atgatttcttcaaagcccagacttgtcgtaccctatggcctcaagactctgctcgagggaattagcagagctgttctcaaaaccaacccatcaaacatcaaccagtttgcagcagcttattttcaagaacttactatgtatagagggaatactactatggatataaaagatctgg
- Show more
|
|
Description: A cloning plasmid for the CABYR gene. |
 Recombinant Human CABYR |
|
P0559 |
FN Test |
100ug |
EUR 522.36 |
- Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
- Reconstitution: Sterile distilled water
- Purity: Greater than 95% by SDS-PAGE gel analyses
- Uniprot ID: O75952
|
|
Description: Recombinant Human protein for CABYR |
 Mouse CABYR shRNA Plasmid |
|
20-abx977359 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CABYR shRNA Plasmid |
|
20-abx958781 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CABYR Recombinant Protein (Human) |
|
RP005416 |
ABM |
100 ug |
Ask for price |
) CABYR Recombinant Protein (Rat) |
|
RP192764 |
ABM |
100 ug |
Ask for price |
) CABYR Recombinant Protein (Mouse) |
|
RP120530 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
|
RP120533 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
|
RP120536 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
|
RP120539 |
ABM |
100 ug |
Ask for price |
CABYR Recombinant Protein (Mouse) |
|
RP120542 |
ABM |
100 ug |
Ask for price |
 Antibody) Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
|
abx036854-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
|
abx029847-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
|
abx029847-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fibrous Sheath CABYR Binding Protein (FSCB) Antibody |
|
20-abx318381 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Cabyr ORF Vector (Rat) (pORF) |
|
ORF064256 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) CABYR ORF Vector (Human) (pORF) |
|
ORF001806 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Cabyr ORF Vector (Mouse) (pORF) |
|
ORF040178 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
|
ORF040179 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
|
ORF040180 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
|
ORF040181 |
ABM |
1.0 ug DNA |
EUR 506 |
Cabyr ORF Vector (Mouse) (pORF) |
|
ORF040182 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA kit) Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
|
E04C1302-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
|
E04C1302-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) ELISA kit |
|
E04C1302-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium binding tyrosine phosphorylation regulated protein(CABYR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Antibody) Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
|
20-abx111304 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
|
20-abx148788 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
|
abx340188-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (HRP) |
|
20-abx307471 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (FITC) |
|
20-abx307472 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Fibrous Sheath CABYR Binding Protein (FSCB) Antibody (Biotin) |
|
20-abx307473 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calcium-Binding Tyrosine Phosphorylation-Regulated Protein (CABYR) Antibody |
|
abx231170-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
) CABYR sgRNA CRISPR Lentivector set (Human) |
|
K0350201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cabyr sgRNA CRISPR Lentivector set (Rat) |
|
K6521601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cabyr sgRNA CRISPR Lentivector set (Mouse) |
|
K4072601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) CABYR sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0350202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CABYR sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0350203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CABYR sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0350204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cabyr sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6521602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cabyr sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6521603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cabyr sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6521604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4072602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4072603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cabyr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4072604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CABYR Protein Vector (Mouse) (pPB-C-His) |
|
PV160710 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CABYR Protein Vector (Mouse) (pPB-N-His) |
|
PV160711 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CABYR Protein Vector (Mouse) (pPM-C-HA) |
|
PV160712 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CABYR Protein Vector (Mouse) (pPM-C-His) |
|
PV160713 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
|
PV160714 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
|
PV160715 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
|
PV160716 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
|
PV160717 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
|
PV160718 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
|
PV160719 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
|
PV160720 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
|
PV160721 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
|
PV160722 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
|
PV160723 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
|
PV160724 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
|
PV160725 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-C-His) |
|
PV160726 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPB-N-His) |
|
PV160727 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-HA) |
|
PV160728 |
ABM |
500 ng |
EUR 603 |
CABYR Protein Vector (Mouse) (pPM-C-His) |
|
PV160729 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CABYR Protein Vector (Rat) (pPB-C-His) |
|
PV257022 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CABYR Protein Vector (Rat) (pPB-N-His) |
|
PV257023 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CABYR Protein Vector (Rat) (pPM-C-HA) |
|
PV257024 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CABYR Protein Vector (Rat) (pPM-C-His) |
|
PV257025 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) CABYR Protein Vector (Human) (pPB-C-His) |
|
PV007221 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CABYR Protein Vector (Human) (pPB-N-His) |
|
PV007222 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CABYR Protein Vector (Human) (pPM-C-HA) |
|
PV007223 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CABYR Protein Vector (Human) (pPM-C-His) |
|
PV007224 |
ABM |
500 ng |
EUR 329 |
 Cabyr 3'UTR GFP Stable Cell Line |
|
TU153009 |
ABM |
1.0 ml |
Ask for price |
 Cabyr 3'UTR Luciferase Stable Cell Line |
|
TU103009 |
ABM |
1.0 ml |
Ask for price |
Cabyr 3'UTR Luciferase Stable Cell Line |
|
TU201540 |
ABM |
1.0 ml |
Ask for price |
Cabyr 3'UTR GFP Stable Cell Line |
|
TU251540 |
ABM |
1.0 ml |
Ask for price |
 CABYR 3'UTR GFP Stable Cell Line |
|
TU053350 |
ABM |
1.0 ml |
EUR 1394 |
 CABYR 3'UTR Luciferase Stable Cell Line |
|
TU003350 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
CABYR Rabbit Polyclonal Antibody
