CAMLG Rabbit Polyclonal Antibody

CAMLG Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CAMLG Polyclonal Antibody
ES9465-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CAMLG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CAMLG Polyclonal Antibody
ES9465-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CAMLG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CAMLG Rabbit pAb
A13720-100ul	Abclonal	100 ul	EUR 308

CAMLG Rabbit pAb
A13720-200ul	Abclonal	200 ul	EUR 459

CAMLG Rabbit pAb
A13720-20ul	Abclonal	20 ul	EUR 183

CAMLG Rabbit pAb
A13720-50ul	Abclonal	50 ul	EUR 223

CAMLG Rabbit pAb
A9561-100ul	Abclonal	100 ul	EUR 308

CAMLG Rabbit pAb
A9561-200ul	Abclonal	200 ul	EUR 459

CAMLG Rabbit pAb
A9561-20ul	Abclonal	20 ul	Ask for price

CAMLG Rabbit pAb
A9561-50ul	Abclonal	50 ul	Ask for price

Polyclonal CAMLG Antibody (Center)
APR15245G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAMLG (Center). This antibody is tested and proven to work in the following applications:

CAMLG antibody
70R-2352	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CAMLG antibody raised against the N terminal of CAMLG

CAMLG antibody
10R-6840	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal CAMLG antibody

CAMLG Antibody
45823-100ul	SAB	100ul	EUR 252

CAMLG Antibody
45823-50ul	SAB	50ul	EUR 187

CAMLG Antibody
1-CSB-PA004475LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF, IP; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:500, IP:1:200-1:2000

CAMLG Antibody
DF9297	Affbiotech	200ul	EUR 304
Description: CAMLG Antibody detects endogenous levels of total CAMLG.

CAMLG Antibody
ABD9297	Lifescience Market	100 ug	EUR 438

CAMLG Conjugated Antibody
C45823	SAB	100ul	EUR 397

anti- CAMLG antibody
FNab01240	FN Test	100µg	EUR 548.75
Immunogen: calcium modulating ligand Uniprot ID: P49069 Gene ID: 819 Research Area: Signal Transduction
Description: Antibody raised against CAMLG

Anti-CAMLG antibody
PAab01240	Lifescience Market	100 ug	EUR 386

Anti-CAMLG antibody
STJ111745	St John's Laboratory	100 µl	EUR 277
Description: The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin.

Anti-CAMLG antibody
STJ115674	St John's Laboratory	100 µl	EUR 277
Description: The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin.

Anti-CAMLG antibody
STJ190623	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to CAMLG

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse)
4-PAC356Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG)

CAMLG siRNA
20-abx910207	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CAMLG siRNA
20-abx910208	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CAMLG
YF-PA10655	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CAMLG

anti-CAMLG
YF-PA10656	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CAMLG

anti-CAMLG
YF-PA23350	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to CAMLG

CAMLG Antibody, HRP conjugated
1-CSB-PA004475LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CAMLG Antibody, FITC conjugated
1-CSB-PA004475LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CAMLG Antibody, Biotin conjugated
1-CSB-PA004475LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), APC
4-PAC356Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), Biotinylated
4-PAC356Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), Cy3
4-PAC356Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), FITC
4-PAC356Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), HRP
4-PAC356Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), PE
4-PAC356Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat)
4-PAC356Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG)

CAMLG Blocking Peptide
33R-5170	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CAMLG antibody, catalog no. 70R-2352

CAMLG Blocking Peptide
DF9297-BP	Affbiotech	1mg	EUR 195

CAMLG cloning plasmid
CSB-CL004475HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 891 Sequence: atggagtcgatggccgtcgctaccgacggcggggagaggccgggggtcccagcgggctcaggtctgtcggcttcccagcgtcgggcggagctgcgtcggagaaagctgctcatgaactcggaacagcgcatcaaccggatcatgggctttcacaggcccgggagcggcgcggaaga Show more
Description: A cloning plasmid for the CAMLG gene.

Anti-CAMLG (3F12)
YF-MA12253	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CAMLG

Calcium Modulating Ligand (CAMLG) Antibody
20-abx124300	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody
20-abx130760	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody
20-abx130761	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody
20-abx130762	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody
20-abx148853	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody
abx032655-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody
abx032655-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody
20-abx338366	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody
abx231240-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat)
4-PAC356Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG)

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC356Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg187) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), APC
4-PAC356Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAC356Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), Cy3
4-PAC356Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), FITC
4-PAC356Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), HRP
4-PAC356Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), PE
4-PAC356Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Antibody (HRP)
20-abx334905	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody (FITC)
20-abx334906	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody (Biotin)
20-abx334907	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

CAMLG protein (His tag)
80R-2932	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant CD300A protein (His tag)

CAMLG ELISA KIT|Human
EF008366	Lifescience Market	96 Tests	EUR 689

Mouse CAMLG shRNA Plasmid
20-abx969453	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CAMLG shRNA Plasmid
20-abx950573	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CAMLG ELISA KIT
ELI-34452h	Lifescience Market	96 Tests	EUR 824

Mouse Camlg ELISA KIT
ELI-49263m	Lifescience Market	96 Tests	EUR 865

CAMLG Recombinant Protein (Human)
RP037699	ABM	100 ug	Ask for price

CAMLG Recombinant Protein (Rat)
RP193004	ABM	100 ug	Ask for price

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAC356Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAC356Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAC356Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAC356Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAC356Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAC356Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAC356Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Met1~Arg188) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit
E04C1344-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit
E04C1344-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit
E04C1344-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAC356Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CAMLG (Gly19~Glu184) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Camlg ORF Vector (Rat) (pORF)
ORF064336	ABM	1.0 ug DNA	EUR 506

CAMLG ORF Vector (Human) (pORF)
ORF012567	ABM	1.0 ug DNA	EUR 354

Recombinant Calcium Modulating Ligand (CAMLG)
4-RPC356Hu01	Cloud-Clone	EUR 404.64 EUR 211.00 EUR 1242.40 EUR 480.80 EUR 861.60 EUR 334.00 EUR 2956.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49069 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Calcium Modulating Ligand expressed in: E.coli

Recombinant Calcium Modulating Ligand (CAMLG)
4-RPC356Mu01	Cloud-Clone	EUR 449.44 EUR 223.00 EUR 1410.40 EUR 536.80 EUR 973.60 EUR 364.00 EUR 3376.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49070 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.1kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Calcium Modulating Ligand expressed in: E.coli

Recombinant Calcium Modulating Ligand (CAMLG)
4-RPC356Ra01	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: F7FMD6 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 50.6kDa Isoelectric Point: Inquire
Description: Recombinant Rat Calcium Modulating Ligand expressed in: E.coli

Human Calcium Modulating Ligand (CAMLG) Protein
20-abx168916	Abbexa	EUR 578.00 EUR 258.00 EUR 1678.00 EUR 676.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Calcium Modulating Ligand (CAMLG) Protein
20-abx168917	Abbexa	EUR 634.00 EUR 272.00 EUR 1901.00 EUR 746.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Calcium Modulating Ligand (CAMLG) Protein
20-abx168918	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CAMLG sgRNA CRISPR Lentivector set (Human)
K0358401	ABM	3 x 1.0 ug	EUR 339

Camlg sgRNA CRISPR Lentivector set (Rat)
K7050201	ABM	3 x 1.0 ug	EUR 339

Human Calcium Modulating Ligand (CAMLG) ELISA Kit
20-abx386275	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Mouse Calcium Modulating Ligand (CAMLG) ELISA Kit
abx388741-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

CAMLG sgRNA CRISPR Lentivector (Human) (Target 1)
K0358402	ABM	1.0 ug DNA	EUR 154

CAMLG sgRNA CRISPR Lentivector (Human) (Target 2)
K0358403	ABM	1.0 ug DNA	EUR 154

CAMLG sgRNA CRISPR Lentivector (Human) (Target 3)
K0358404	ABM	1.0 ug DNA	EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 1)
K7050202	ABM	1.0 ug DNA	EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 2)
K7050203	ABM	1.0 ug DNA	EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 3)
K7050204	ABM	1.0 ug DNA	EUR 154

CAMLG Calcium Modulating Ligand Human Recombinant Protein
PROTP49069	BosterBio	Regular: 20ug	EUR 317
Description: CAMLG Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 212 amino acids (1-189) and having a molecular mass of 23.2kDa.

CAMLG Protein Vector (Rat) (pPB-C-His)
PV257342	ABM	500 ng	EUR 603

CAMLG Protein Vector (Rat) (pPB-N-His)
PV257343	ABM	500 ng	EUR 603

CAMLG Protein Vector (Rat) (pPM-C-HA)
PV257344	ABM	500 ng	EUR 603

CAMLG Protein Vector (Rat) (pPM-C-His)
PV257345	ABM	500 ng	EUR 603

CAMLG Protein Vector (Human) (pPB-C-His)
PV050265	ABM	500 ng	EUR 481

CAMLG Protein Vector (Human) (pPB-N-His)
PV050266	ABM	500 ng	EUR 481

CAMLG Protein Vector (Human) (pPM-C-HA)
PV050267	ABM	500 ng	EUR 481

CAMLG Protein Vector (Human) (pPM-C-His)
PV050268	ABM	500 ng	EUR 481

Recombinant Human CAMLG Protein, His, E.coli-1mg
QP11269-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human CAMLG Protein, His, E.coli-20ug
QP11269-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human CAMLG Protein, His, E.coli-5ug
QP11269-5ug	EnQuireBio	5ug	EUR 155

Camlg 3'UTR Luciferase Stable Cell Line
TU201614	ABM	1.0 ml	Ask for price

Camlg 3'UTR GFP Stable Cell Line
TU251614	ABM	1.0 ml	Ask for price

CAMLG 3'UTR GFP Stable Cell Line
TU053433	ABM	1.0 ml	EUR 1394

CAMLG 3'UTR Luciferase Stable Cell Line
TU003433	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CAMLG Rabbit Polyclonal Antibody