CAMLG Rabbit Polyclonal Antibody

CAMLG Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CAMLG Polyclonal Antibody

ES9465-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CAMLG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CAMLG Polyclonal Antibody

ES9465-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CAMLG from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CAMLG Rabbit pAb

A13720-100ul 100 ul
EUR 308

CAMLG Rabbit pAb

A13720-200ul 200 ul
EUR 459

CAMLG Rabbit pAb

A13720-20ul 20 ul
EUR 183

CAMLG Rabbit pAb

A13720-50ul 50 ul
EUR 223

CAMLG Rabbit pAb

A9561-100ul 100 ul
EUR 308

CAMLG Rabbit pAb

A9561-200ul 200 ul
EUR 459

CAMLG Rabbit pAb

A9561-20ul 20 ul Ask for price

CAMLG Rabbit pAb

A9561-50ul 50 ul Ask for price

Polyclonal CAMLG Antibody (Center)

APR15245G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CAMLG (Center). This antibody is tested and proven to work in the following applications:

CAMLG antibody

70R-2352 50 ug
EUR 467
Description: Rabbit polyclonal CAMLG antibody raised against the N terminal of CAMLG

CAMLG antibody

10R-6840 100 ul
EUR 691
Description: Mouse monoclonal CAMLG antibody

CAMLG Antibody

45823-100ul 100ul
EUR 252

CAMLG Antibody

45823-50ul 50ul
EUR 187

CAMLG Antibody

1-CSB-PA004475LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF, IP; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:500, IP:1:200-1:2000

CAMLG Antibody

DF9297 200ul
EUR 304
Description: CAMLG Antibody detects endogenous levels of total CAMLG.

CAMLG Antibody

ABD9297 100 ug
EUR 438

CAMLG Conjugated Antibody

C45823 100ul
EUR 397

anti- CAMLG antibody

FNab01240 100µg
EUR 548.75
  • Immunogen: calcium modulating ligand
  • Uniprot ID: P49069
  • Gene ID: 819
  • Research Area: Signal Transduction
Description: Antibody raised against CAMLG

Anti-CAMLG antibody

PAab01240 100 ug
EUR 386

Anti-CAMLG antibody

STJ111745 100 µl
EUR 277
Description: The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin.

Anti-CAMLG antibody

STJ115674 100 µl
EUR 277
Description: The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin.

Anti-CAMLG antibody

STJ190623 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CAMLG

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse)

4-PAC356Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG)

CAMLG siRNA

20-abx910207
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAMLG siRNA

20-abx910208
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CAMLG

YF-PA10655 50 ug
EUR 363
Description: Mouse polyclonal to CAMLG

anti-CAMLG

YF-PA10656 100 ug
EUR 403
Description: Rabbit polyclonal to CAMLG

anti-CAMLG

YF-PA23350 50 ul
EUR 334
Description: Mouse polyclonal to CAMLG

CAMLG Antibody, HRP conjugated

1-CSB-PA004475LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CAMLG Antibody, FITC conjugated

1-CSB-PA004475LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CAMLG Antibody, Biotin conjugated

1-CSB-PA004475LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAMLG. Recognizes CAMLG from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), APC

4-PAC356Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), Biotinylated

4-PAC356Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), Cy3

4-PAC356Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), FITC

4-PAC356Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), HRP

4-PAC356Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), PE

4-PAC356Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat)

4-PAC356Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG)

CAMLG Blocking Peptide

33R-5170 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CAMLG antibody, catalog no. 70R-2352

CAMLG Blocking Peptide

DF9297-BP 1mg
EUR 195

CAMLG cloning plasmid

CSB-CL004475HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atggagtcgatggccgtcgctaccgacggcggggagaggccgggggtcccagcgggctcaggtctgtcggcttcccagcgtcgggcggagctgcgtcggagaaagctgctcatgaactcggaacagcgcatcaaccggatcatgggctttcacaggcccgggagcggcgcggaaga
  • Show more
Description: A cloning plasmid for the CAMLG gene.

Anti-CAMLG (3F12)

YF-MA12253 100 ug
EUR 363
Description: Mouse monoclonal to CAMLG

Calcium Modulating Ligand (CAMLG) Antibody

20-abx124300
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody

20-abx130760
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody

20-abx130761
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody

20-abx130762
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Modulating Ligand (CAMLG) Antibody

20-abx148853
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody

abx032655-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody

abx032655-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody

20-abx338366
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody

abx231240-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat)

4-PAC356Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG)

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC356Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg187)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), APC

4-PAC356Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAC356Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), Cy3

4-PAC356Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), FITC

4-PAC356Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), HRP

4-PAC356Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), PE

4-PAC356Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Antibody (HRP)

20-abx334905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody (FITC)

20-abx334906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Modulating Ligand (CAMLG) Antibody (Biotin)

20-abx334907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CAMLG protein (His tag)

80R-2932 100 ug
EUR 327
Description: Purified recombinant CD300A protein (His tag)

CAMLG ELISA KIT|Human

EF008366 96 Tests
EUR 689

Mouse CAMLG shRNA Plasmid

20-abx969453
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CAMLG shRNA Plasmid

20-abx950573
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CAMLG ELISA KIT

ELI-34452h 96 Tests
EUR 824

Mouse Camlg ELISA KIT

ELI-49263m 96 Tests
EUR 865

CAMLG Recombinant Protein (Human)

RP037699 100 ug Ask for price

CAMLG Recombinant Protein (Rat)

RP193004 100 ug Ask for price

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), APC

4-PAC356Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

4-PAC356Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Biotin.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), Cy3

4-PAC356Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with Cy3.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), FITC

4-PAC356Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with FITC.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), HRP

4-PAC356Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with HRP.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), PE

4-PAC356Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with PE.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAC356Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Met1~Arg188)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit

E04C1344-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit

E04C1344-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) ELISA kit

E04C1344-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium signal modulating cyclophilin ligand(CAMLG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calcium Modulating Ligand (CAMLG) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

4-PAC356Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CAMLG (Gly19~Glu184)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Calcium Modulating Ligand (CAMLG). This antibody is labeled with APC-Cy7.

Camlg ORF Vector (Rat) (pORF)

ORF064336 1.0 ug DNA
EUR 506

CAMLG ORF Vector (Human) (pORF)

ORF012567 1.0 ug DNA
EUR 354

Recombinant Calcium Modulating Ligand (CAMLG)

4-RPC356Hu01
  • EUR 404.64
  • EUR 211.00
  • EUR 1242.40
  • EUR 480.80
  • EUR 861.60
  • EUR 334.00
  • EUR 2956.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49069
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calcium Modulating Ligand expressed in: E.coli

Recombinant Calcium Modulating Ligand (CAMLG)

4-RPC356Mu01
  • EUR 449.44
  • EUR 223.00
  • EUR 1410.40
  • EUR 536.80
  • EUR 973.60
  • EUR 364.00
  • EUR 3376.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49070
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Calcium Modulating Ligand expressed in: E.coli

Recombinant Calcium Modulating Ligand (CAMLG)

4-RPC356Ra01
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F7FMD6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 50.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Calcium Modulating Ligand expressed in: E.coli

Human Calcium Modulating Ligand (CAMLG) Protein

20-abx168916
  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Calcium Modulating Ligand (CAMLG) Protein

20-abx168917
  • EUR 634.00
  • EUR 272.00
  • EUR 1901.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Calcium Modulating Ligand (CAMLG) Protein

20-abx168918
  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CAMLG sgRNA CRISPR Lentivector set (Human)

K0358401 3 x 1.0 ug
EUR 339

Camlg sgRNA CRISPR Lentivector set (Rat)

K7050201 3 x 1.0 ug
EUR 339

Human Calcium Modulating Ligand (CAMLG) ELISA Kit

20-abx386275
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Mouse Calcium Modulating Ligand (CAMLG) ELISA Kit

abx388741-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

CAMLG sgRNA CRISPR Lentivector (Human) (Target 1)

K0358402 1.0 ug DNA
EUR 154

CAMLG sgRNA CRISPR Lentivector (Human) (Target 2)

K0358403 1.0 ug DNA
EUR 154

CAMLG sgRNA CRISPR Lentivector (Human) (Target 3)

K0358404 1.0 ug DNA
EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 1)

K7050202 1.0 ug DNA
EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 2)

K7050203 1.0 ug DNA
EUR 154

Camlg sgRNA CRISPR Lentivector (Rat) (Target 3)

K7050204 1.0 ug DNA
EUR 154

CAMLG Calcium Modulating Ligand Human Recombinant Protein

PROTP49069 Regular: 20ug
EUR 317
Description: CAMLG Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 212 amino acids (1-189) and having a molecular mass of 23.2kDa.

CAMLG Protein Vector (Rat) (pPB-C-His)

PV257342 500 ng
EUR 603

CAMLG Protein Vector (Rat) (pPB-N-His)

PV257343 500 ng
EUR 603

CAMLG Protein Vector (Rat) (pPM-C-HA)

PV257344 500 ng
EUR 603

CAMLG Protein Vector (Rat) (pPM-C-His)

PV257345 500 ng
EUR 603

CAMLG Protein Vector (Human) (pPB-C-His)

PV050265 500 ng
EUR 481

CAMLG Protein Vector (Human) (pPB-N-His)

PV050266 500 ng
EUR 481

CAMLG Protein Vector (Human) (pPM-C-HA)

PV050267 500 ng
EUR 481

CAMLG Protein Vector (Human) (pPM-C-His)

PV050268 500 ng
EUR 481

Recombinant Human CAMLG Protein, His, E.coli-1mg

QP11269-1mg 1mg
EUR 2757

Recombinant Human CAMLG Protein, His, E.coli-20ug

QP11269-20ug 20ug
EUR 201

Recombinant Human CAMLG Protein, His, E.coli-5ug

QP11269-5ug 5ug
EUR 155

Camlg 3'UTR Luciferase Stable Cell Line

TU201614 1.0 ml Ask for price

Camlg 3'UTR GFP Stable Cell Line

TU251614 1.0 ml Ask for price

CAMLG 3'UTR GFP Stable Cell Line

TU053433 1.0 ml
EUR 1394

CAMLG 3'UTR Luciferase Stable Cell Line

TU003433 1.0 ml
EUR 1394

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CAMLG Rabbit Polyclonal Antibody