CBLB Rabbit Polyclonal Antibody
CBLB Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
CBLB Polyclonal Antibody |
ES9621-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CBLB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CBLB Polyclonal Antibody |
ES9621-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CBLB from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CBLB Rabbit pAb |
A2014-100ul |
Abclonal |
100 ul |
EUR 308 |
CBLB Rabbit pAb |
A2014-200ul |
Abclonal |
200 ul |
EUR 459 |
CBLB Rabbit pAb |
A2014-20ul |
Abclonal |
20 ul |
EUR 183 |
CBLB Rabbit pAb |
A2014-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal CBLB Antibody (Center) |
APR06112G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CBLB (Center). This antibody is tested and proven to work in the following applications: |
CBLB antibody |
70R-16192 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CBLB antibody |
CBLB Antibody |
32551-100ul |
SAB |
100ul |
EUR 252 |
CBLB antibody |
10R-1493 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal CBLB antibody |
CBLB Antibody |
1-CSB-PA004579GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CBLB. Recognizes CBLB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
CBLB Antibody |
DF6753 |
Affbiotech |
200ul |
EUR 304 |
Description: CBLB Antibody detects endogenous levels of total CBLB. |
CBLB Conjugated Antibody |
C32551 |
SAB |
100ul |
EUR 397 |
anti- CBLB antibody |
FNab01318 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: Cas-Br-M (murine) ecotropic retroviral transforming sequence b
- Uniprot ID: Q13191
- Gene ID: 868
- Research Area: Epigenetics, Signal Transduction, Metabolism
|
Description: Antibody raised against CBLB |
Anti-CBLB antibody |
STJ190779 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CBLB |
CBLB siRNA |
20-abx900811 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CBLB siRNA |
20-abx910395 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CBLB siRNA |
20-abx910396 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CBLB Blocking Peptide |
DF6753-BP |
Affbiotech |
1mg |
EUR 195 |
CBLB cloning plasmid |
CSB-CL623789HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2949
- Sequence: atggcaaactcaatgaatggcagaaaccctggtggtcgaggaggaaatccccgaaaaggtcgaattttgggtattattgatgctattcaggatgcagttggaccccctaagcaagctgccgcagatcgcaggaccgtggagaagacttggaagctcatggacaaagtggtaagac
- Show more
|
Description: A cloning plasmid for the CBLB gene. |
Rat CBLB shRNA Plasmid |
20-abx987706 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CBLB shRNA Plasmid |
20-abx980562 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CBLB shRNA Plasmid |
20-abx950613 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Cblb ORF Vector (Rat) (pORF) |
ORF064428 |
ABM |
1.0 ug DNA |
EUR 506 |
CBLB ORF Vector (Human) (pORF) |
ORF001905 |
ABM |
1.0 ug DNA |
EUR 95 |
Cblb ORF Vector (Mouse) (pORF) |
ORF040465 |
ABM |
1.0 ug DNA |
EUR 506 |
E3 Ubiquitin-Protein Ligase CBL-B (CBLB) Antibody |
abx231318-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CBLB sgRNA CRISPR Lentivector set (Human) |
K0368701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cblb sgRNA CRISPR Lentivector set (Rat) |
K7063701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cblb sgRNA CRISPR Lentivector set (Mouse) |
K3647701 |
ABM |
3 x 1.0 ug |
EUR 339 |
CBLB sgRNA CRISPR Lentivector (Human) (Target 1) |
K0368702 |
ABM |
1.0 ug DNA |
EUR 154 |
CBLB sgRNA CRISPR Lentivector (Human) (Target 2) |
K0368703 |
ABM |
1.0 ug DNA |
EUR 154 |
CBLB sgRNA CRISPR Lentivector (Human) (Target 3) |
K0368704 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7063702 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7063703 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7063704 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3647702 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3647703 |
ABM |
1.0 ug DNA |
EUR 154 |
Cblb sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3647704 |
ABM |
1.0 ug DNA |
EUR 154 |
CBLB Protein Vector (Mouse) (pPB-C-His) |
PV161858 |
ABM |
500 ng |
EUR 1065 |
CBLB Protein Vector (Mouse) (pPB-N-His) |
PV161859 |
ABM |
500 ng |
EUR 1065 |
CBLB Protein Vector (Mouse) (pPM-C-HA) |
PV161860 |
ABM |
500 ng |
EUR 1065 |
CBLB Protein Vector (Mouse) (pPM-C-His) |
PV161861 |
ABM |
500 ng |
EUR 1065 |
CBLB Protein Vector (Rat) (pPB-C-His) |
PV257710 |
ABM |
500 ng |
EUR 1166 |
CBLB Protein Vector (Rat) (pPB-N-His) |
PV257711 |
ABM |
500 ng |
EUR 1166 |
CBLB Protein Vector (Rat) (pPM-C-HA) |
PV257712 |
ABM |
500 ng |
EUR 1166 |
CBLB Protein Vector (Rat) (pPM-C-His) |
PV257713 |
ABM |
500 ng |
EUR 1166 |
CBLB Protein Vector (Human) (pPB-C-His) |
PV007617 |
ABM |
500 ng |
EUR 329 |
CBLB Protein Vector (Human) (pPB-N-His) |
PV007618 |
ABM |
500 ng |
EUR 329 |
CBLB Protein Vector (Human) (pPM-C-HA) |
PV007619 |
ABM |
500 ng |
EUR 329 |
CBLB Protein Vector (Human) (pPM-C-His) |
PV007620 |
ABM |
500 ng |
EUR 329 |
Cblb 3'UTR GFP Stable Cell Line |
TU153187 |
ABM |
1.0 ml |
Ask for price |
Cblb 3'UTR Luciferase Stable Cell Line |
TU103187 |
ABM |
1.0 ml |
Ask for price |
Cblb 3'UTR Luciferase Stable Cell Line |
TU201707 |
ABM |
1.0 ml |
Ask for price |
Cblb 3'UTR GFP Stable Cell Line |
TU251707 |
ABM |
1.0 ml |
Ask for price |
CBLB 3'UTR GFP Stable Cell Line |
TU053538 |
ABM |
1.0 ml |
EUR 2333 |
CBLB 3'UTR Luciferase Stable Cell Line |
TU003538 |
ABM |
1.0 ml |
EUR 2333 |
CBLB ELISA Kit (Human) : 96 Wells (OKEH01653) |
OKEH01653 |
Aviva Systems Biology |
96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 25 pg/mL |
Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody |
20-abx111410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody |
abx034055-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody |
abx034055-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Cbl Proto-Oncogene B, E3 Ubiquitin Protein Ligase (CBLB) Antibody |
20-abx225075 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
CBLB Rabbit Polyclonal Antibody