CHERP Rabbit Polyclonal Antibody

CHERP Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CHERP Polyclonal Antibody

ABP58141-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CHERP protein
  • Applications tips:
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein

CHERP Polyclonal Antibody

ABP58141-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CHERP protein
  • Applications tips:
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein

CHERP Polyclonal Antibody

ABP58141-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CHERP protein
  • Applications tips:
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein

CHERP Rabbit pAb

A9702-100ul 100 ul
EUR 308

CHERP Rabbit pAb

A9702-200ul 200 ul
EUR 459

CHERP Rabbit pAb

A9702-20ul 20 ul
EUR 183

CHERP Rabbit pAb

A9702-50ul 50 ul
EUR 223

CHERP Antibody

ABD9296 100 ug
EUR 438

CHERP antibody

70R-50810 100 ul
EUR 244
Description: Purified Polyclonal CHERP antibody

CHERP antibody

70R-5261 50 ug
EUR 467
Description: Rabbit polyclonal CHERP antibody raised against the middle region of CHERP

CHERP antibody

70R-5262 50 ug
EUR 467
Description: Rabbit polyclonal CHERP antibody raised against the middle region of CHERP

CHERP Antibody

45822-100ul 100ul
EUR 252

CHERP Antibody

45822-50ul 50ul
EUR 187

CHERP Antibody

46951-100ul 100ul
EUR 252

CHERP Antibody

DF9296 200ul
EUR 304
Description: CHERP Antibody detects endogenous levels of total CHERP.

Polyclonal CHERP Antibody (C-term)

APR15440G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHERP (C-term). This antibody is tested and proven to work in the following applications:

CHERP Conjugated Antibody

C45822 100ul
EUR 397

CHERP Conjugated Antibody

C46951 100ul
EUR 397

anti- CHERP antibody

FNab01647 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: calcium homeostasis endoplasmic reticulum protein
  • Uniprot ID: Q8IWX8
  • Gene ID: 10523
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against CHERP

Anti-CHERP antibody

PAab01647 100 ug
EUR 355

Anti-CHERP Antibody

STJ500534 100 µg
EUR 476

Anti-CHERP antibody

STJ111795 100 µl
EUR 277

Anti-CHERP antibody

STJ190622 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CHERP

CHERP siRNA

20-abx911681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHERP siRNA

20-abx911682
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CHERP

YF-PA17018 50 ug
EUR 363
Description: Mouse polyclonal to CHERP

anti-CHERP

YF-PA25603 50 ul
EUR 334
Description: Mouse polyclonal to CHERP

Anti-CHERP Antibody (Biotin)

STJ500535 100 µg
EUR 586

Anti-CHERP Antibody (FITC)

STJ500536 100 µg
EUR 586

CHERP cloning plasmid

CSB-CL005340HU-10ug 10ug
EUR 853
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2655
  • Sequence: atgactatggagaagcagaaggacaaccccaaattctcgtttcttttcggaggcgaattctacagttactacaagtgcaagctggcgctggagcagcagcagctcatctgcaagcagcagaccccggagctggagccagccgccaccatgccacccctgccacagcccccgctgg
  • Show more
Description: A cloning plasmid for the CHERP gene.

CHERP Blocking Peptide

20-abx063685
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CHERP Blocking Peptide

33R-2664 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHERP antibody, catalog no. 70R-5261

CHERP Blocking Peptide

33R-8400 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHERP antibody, catalog no. 70R-5262

CHERP Blocking Peptide

DF9296-BP 1mg
EUR 195

Anti-CHERP (2H5)

YF-MA17352 50 ug
EUR 363
Description: Mouse monoclonal to CHERP

Anti-CHERP (1A5)

YF-MA17353 100 ug
EUR 363
Description: Mouse monoclonal to CHERP

Mouse CHERP shRNA Plasmid

20-abx973934
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CHERP ELISA KIT|Human

EF008636 96 Tests
EUR 689

Human CHERP ELISA KIT

ELI-50075h 96 Tests
EUR 824

Mouse Cherp ELISA KIT

ELI-50076m 96 Tests
EUR 865

Human CHERP shRNA Plasmid

20-abx957150
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit

E04C1674-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit

E04C1674-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit

E04C1674-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal CHERP Antibody (monoclonal) (M01), Clone: 2H5

APR15441G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human CHERP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H5. This antibody is applicable in WB

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

20-abx124113
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

20-abx149293
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

20-abx008326
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

abx029586-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

abx029586-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

20-abx175669
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody

abx231647-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CHERP ORF Vector (Human) (pORF)

ORF002328 1.0 ug DNA
EUR 95

Cherp ORF Vector (Rat) (pORF)

ORF064940 1.0 ug DNA
EUR 506

Cherp ORF Vector (Mouse) (pORF)

ORF041299 1.0 ug DNA
EUR 506

CHERP sgRNA CRISPR Lentivector set (Human)

K0444101 3 x 1.0 ug
EUR 339

Cherp sgRNA CRISPR Lentivector set (Mouse)

K5004801 3 x 1.0 ug
EUR 339

Cherp sgRNA CRISPR Lentivector set (Rat)

K6748401 3 x 1.0 ug
EUR 339

CHERP sgRNA CRISPR Lentivector (Human) (Target 1)

K0444102 1.0 ug DNA
EUR 154

CHERP sgRNA CRISPR Lentivector (Human) (Target 2)

K0444103 1.0 ug DNA
EUR 154

CHERP sgRNA CRISPR Lentivector (Human) (Target 3)

K0444104 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5004802 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5004803 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5004804 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Rat) (Target 1)

K6748402 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Rat) (Target 2)

K6748403 1.0 ug DNA
EUR 154

Cherp sgRNA CRISPR Lentivector (Rat) (Target 3)

K6748404 1.0 ug DNA
EUR 154

Recombinant Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP)

4-RPF406Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWX8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Calcium Homeostasis Endoplasmic Reticulum Protein expressed in: E.coli

CHERP Protein Vector (Human) (pPB-C-His)

PV009309 500 ng
EUR 329

CHERP Protein Vector (Human) (pPB-N-His)

PV009310 500 ng
EUR 329

CHERP Protein Vector (Human) (pPM-C-HA)

PV009311 500 ng
EUR 329

CHERP Protein Vector (Human) (pPM-C-His)

PV009312 500 ng
EUR 329

CHERP Protein Vector (Rat) (pPB-C-His)

PV259758 500 ng
EUR 1191

CHERP Protein Vector (Rat) (pPB-N-His)

PV259759 500 ng
EUR 1191

CHERP Protein Vector (Rat) (pPM-C-HA)

PV259760 500 ng
EUR 1191

CHERP Protein Vector (Rat) (pPM-C-His)

PV259761 500 ng
EUR 1191

CHERP Protein Vector (Mouse) (pPB-C-His)

PV165194 500 ng
EUR 1065

CHERP Protein Vector (Mouse) (pPB-N-His)

PV165195 500 ng
EUR 1065

CHERP Protein Vector (Mouse) (pPM-C-HA)

PV165196 500 ng
EUR 1065

CHERP Protein Vector (Mouse) (pPM-C-His)

PV165197 500 ng
EUR 1065

Cherp 3'UTR Luciferase Stable Cell Line

TU202274 1.0 ml Ask for price

Cherp 3'UTR GFP Stable Cell Line

TU153824 1.0 ml Ask for price

CHERP 3'UTR Luciferase Stable Cell Line

TU004343 1.0 ml
EUR 1394

Cherp 3'UTR Luciferase Stable Cell Line

TU103824 1.0 ml Ask for price

CHERP 3'UTR GFP Stable Cell Line

TU054343 1.0 ml
EUR 1394

Cherp 3'UTR GFP Stable Cell Line

TU252274 1.0 ml Ask for price

Human Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Protein

20-abx650661
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cherp ELISA Kit| Mouse Calcium homeostasis endoplasmic reticulu

EF014365 96 Tests
EUR 689

CHERP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV624643 1.0 ug DNA
EUR 1355

CHERP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV624647 1.0 ug DNA
EUR 1355

CHERP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV624648 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody

ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CHERP Rabbit Polyclonal Antibody