CHERP Rabbit Polyclonal Antibody
CHERP Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
CHERP Polyclonal Antibody |
ABP58141-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CHERP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein |
CHERP Polyclonal Antibody |
ABP58141-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CHERP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein |
CHERP Polyclonal Antibody |
ABP58141-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CHERP protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CHERP from Human, Mouse. This CHERP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHERP protein |
CHERP Rabbit pAb |
A9702-100ul |
Abclonal |
100 ul |
EUR 308 |
CHERP Rabbit pAb |
A9702-200ul |
Abclonal |
200 ul |
EUR 459 |
CHERP Rabbit pAb |
A9702-20ul |
Abclonal |
20 ul |
EUR 183 |
CHERP Rabbit pAb |
A9702-50ul |
Abclonal |
50 ul |
EUR 223 |
CHERP antibody |
70R-50810 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal CHERP antibody |
CHERP antibody |
70R-5261 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CHERP antibody raised against the middle region of CHERP |
CHERP antibody |
70R-5262 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CHERP antibody raised against the middle region of CHERP |
CHERP Antibody |
45822-100ul |
SAB |
100ul |
EUR 252 |
CHERP Antibody |
45822-50ul |
SAB |
50ul |
EUR 187 |
CHERP Antibody |
46951-100ul |
SAB |
100ul |
EUR 252 |
CHERP Antibody |
DF9296 |
Affbiotech |
200ul |
EUR 304 |
Description: CHERP Antibody detects endogenous levels of total CHERP. |
Polyclonal CHERP Antibody (C-term) |
APR15440G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHERP (C-term). This antibody is tested and proven to work in the following applications: |
CHERP Conjugated Antibody |
C45822 |
SAB |
100ul |
EUR 397 |
CHERP Conjugated Antibody |
C46951 |
SAB |
100ul |
EUR 397 |
anti- CHERP antibody |
FNab01647 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IHC: 1:20-1:200
- Immunogen: calcium homeostasis endoplasmic reticulum protein
- Uniprot ID: Q8IWX8
- Gene ID: 10523
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against CHERP |
Anti-CHERP antibody |
STJ190622 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CHERP |
CHERP siRNA |
20-abx911681 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHERP siRNA |
20-abx911682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CHERP |
YF-PA17018 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CHERP |
anti-CHERP |
YF-PA25603 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to CHERP |
CHERP cloning plasmid |
CSB-CL005340HU-10ug |
Cusabio |
10ug |
EUR 853 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2655
- Sequence: atgactatggagaagcagaaggacaaccccaaattctcgtttcttttcggaggcgaattctacagttactacaagtgcaagctggcgctggagcagcagcagctcatctgcaagcagcagaccccggagctggagccagccgccaccatgccacccctgccacagcccccgctgg
- Show more
|
Description: A cloning plasmid for the CHERP gene. |
CHERP Blocking Peptide |
20-abx063685 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CHERP Blocking Peptide |
33R-2664 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHERP antibody, catalog no. 70R-5261 |
CHERP Blocking Peptide |
33R-8400 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CHERP antibody, catalog no. 70R-5262 |
CHERP Blocking Peptide |
DF9296-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-CHERP (2H5) |
YF-MA17352 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to CHERP |
Anti-CHERP (1A5) |
YF-MA17353 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CHERP |
Mouse CHERP shRNA Plasmid |
20-abx973934 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CHERP shRNA Plasmid |
20-abx957150 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit |
E04C1674-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit |
E04C1674-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) ELISA kit |
E04C1674-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Calcium homeostasis endoplasmic reticulum protein(CHERP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monoclonal CHERP Antibody (monoclonal) (M01), Clone: 2H5 |
APR15441G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A Monoclonal antibody against Human CHERP (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H5. This antibody is applicable in WB |
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
20-abx124113 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
20-abx149293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
20-abx008326 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
abx029586-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
abx029586-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
20-abx175669 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Antibody |
abx231647-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CHERP ORF Vector (Human) (pORF) |
ORF002328 |
ABM |
1.0 ug DNA |
EUR 95 |
Cherp ORF Vector (Rat) (pORF) |
ORF064940 |
ABM |
1.0 ug DNA |
EUR 506 |
Cherp ORF Vector (Mouse) (pORF) |
ORF041299 |
ABM |
1.0 ug DNA |
EUR 506 |
CHERP sgRNA CRISPR Lentivector set (Human) |
K0444101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cherp sgRNA CRISPR Lentivector set (Mouse) |
K5004801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cherp sgRNA CRISPR Lentivector set (Rat) |
K6748401 |
ABM |
3 x 1.0 ug |
EUR 339 |
CHERP sgRNA CRISPR Lentivector (Human) (Target 1) |
K0444102 |
ABM |
1.0 ug DNA |
EUR 154 |
CHERP sgRNA CRISPR Lentivector (Human) (Target 2) |
K0444103 |
ABM |
1.0 ug DNA |
EUR 154 |
CHERP sgRNA CRISPR Lentivector (Human) (Target 3) |
K0444104 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5004802 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5004803 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5004804 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6748402 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6748403 |
ABM |
1.0 ug DNA |
EUR 154 |
Cherp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6748404 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) |
4-RPF406Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q8IWX8
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 24.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Calcium Homeostasis Endoplasmic Reticulum Protein expressed in: E.coli |
CHERP Protein Vector (Human) (pPB-C-His) |
PV009309 |
ABM |
500 ng |
EUR 329 |
CHERP Protein Vector (Human) (pPB-N-His) |
PV009310 |
ABM |
500 ng |
EUR 329 |
CHERP Protein Vector (Human) (pPM-C-HA) |
PV009311 |
ABM |
500 ng |
EUR 329 |
CHERP Protein Vector (Human) (pPM-C-His) |
PV009312 |
ABM |
500 ng |
EUR 329 |
CHERP Protein Vector (Rat) (pPB-C-His) |
PV259758 |
ABM |
500 ng |
EUR 1191 |
CHERP Protein Vector (Rat) (pPB-N-His) |
PV259759 |
ABM |
500 ng |
EUR 1191 |
CHERP Protein Vector (Rat) (pPM-C-HA) |
PV259760 |
ABM |
500 ng |
EUR 1191 |
CHERP Protein Vector (Rat) (pPM-C-His) |
PV259761 |
ABM |
500 ng |
EUR 1191 |
CHERP Protein Vector (Mouse) (pPB-C-His) |
PV165194 |
ABM |
500 ng |
EUR 1065 |
CHERP Protein Vector (Mouse) (pPB-N-His) |
PV165195 |
ABM |
500 ng |
EUR 1065 |
CHERP Protein Vector (Mouse) (pPM-C-HA) |
PV165196 |
ABM |
500 ng |
EUR 1065 |
CHERP Protein Vector (Mouse) (pPM-C-His) |
PV165197 |
ABM |
500 ng |
EUR 1065 |
Cherp 3'UTR Luciferase Stable Cell Line |
TU202274 |
ABM |
1.0 ml |
Ask for price |
Cherp 3'UTR GFP Stable Cell Line |
TU153824 |
ABM |
1.0 ml |
Ask for price |
CHERP 3'UTR Luciferase Stable Cell Line |
TU004343 |
ABM |
1.0 ml |
EUR 1394 |
Cherp 3'UTR Luciferase Stable Cell Line |
TU103824 |
ABM |
1.0 ml |
Ask for price |
CHERP 3'UTR GFP Stable Cell Line |
TU054343 |
ABM |
1.0 ml |
EUR 1394 |
Cherp 3'UTR GFP Stable Cell Line |
TU252274 |
ABM |
1.0 ml |
Ask for price |
Human Calcium Homeostasis Endoplasmic Reticulum Protein (CHERP) Protein |
20-abx650661 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cherp ELISA Kit| Mouse Calcium homeostasis endoplasmic reticulu |
EF014365 |
Lifescience Market |
96 Tests |
EUR 689 |
CHERP Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV624643 |
ABM |
1.0 ug DNA |
EUR 1355 |
CHERP Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV624647 |
ABM |
1.0 ug DNA |
EUR 1355 |
CHERP Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV624648 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CHERP Rabbit Polyclonal Antibody