CNTFR Rabbit Polyclonal Antibody

CNTFR Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

CNTFR Polyclonal Antibody

ABP58211-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
  • Applications tips:
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein

CNTFR Polyclonal Antibody

A50133 100 µg
EUR 570.55
Description: The best epigenetics products

CNTFR Polyclonal Antibody

ES9543-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CNTFR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNTFR Polyclonal Antibody

ES9543-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CNTFR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

CNTFR Rabbit pAb

A12424-100ul 100 ul
EUR 308

CNTFR Rabbit pAb

A12424-200ul 200 ul
EUR 459

CNTFR Rabbit pAb

A12424-20ul 20 ul
EUR 183

CNTFR Rabbit pAb

A12424-50ul 50 ul
EUR 223

CNTFR Rabbit pAb

A2700-100ul 100 ul
EUR 308

CNTFR Rabbit pAb

A2700-200ul 200 ul
EUR 459

CNTFR Rabbit pAb

A2700-20ul 20 ul
EUR 183

CNTFR Rabbit pAb

A2700-50ul 50 ul
EUR 223

CNTFR Antibody

31061-100ul 100ul
EUR 252

CNTFR Antibody

31061-50ul 50ul
EUR 187

CNTFR antibody

70R-16487 50 ul
EUR 435
Description: Rabbit polyclonal CNTFR antibody

CNTFR antibody

38442-100ul 100ul
EUR 252

CNTFR Antibody

1-CSB-PA005684EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200

CNTFR Antibody

1-CSB-PA005684GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CNTFR Antibody

DF7058 200ul
EUR 304
Description: CNTFR Antibody detects endogenous levels of total CNTFR.

CNTFR Antibody

CSB-PA276708-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CNTFR Antibody

CSB-PA276708-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

CNTFR Antibody

CSB-PA204475-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

CNTFR Antibody

CSB-PA204475-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000

CNTFR antibody

70R-9962 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal CNTFR antibody

CNTFR Antibody

abx332250-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

CNTFR Antibody

ABD7058 100 ug
EUR 438

Rabbit CNTFR ELISA Kit

ERTC0039 96Tests
EUR 521

Polyclonal Goat Anti-CNTFR Antibody

APG03349G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CNTFR . This antibody is tested and proven to work in the following applications:

CNTFR Polyclonal Antibody, HRP Conjugated

A50134 100 µg
EUR 570.55
Description: kits suitable for this type of research

CNTFR Polyclonal Antibody, FITC Conjugated

A50135 100 µg
EUR 570.55
Description: fast delivery possible

CNTFR Polyclonal Antibody, Biotin Conjugated

A50136 100 µg
EUR 570.55
Description: reagents widely cited

Polyclonal CNTFR antibody - C-terminal region

APG03229G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNTFR - C-terminal region. This antibody is tested and proven to work in the following applications:

CNTFR alpha antibody

20R-2754 50 ug
EUR 281
Description: Rabbit polyclonal CNTFR alpha antibody

CNTFR Conjugated Antibody

C31061 100ul
EUR 397

CNTFR Conjugated Antibody

C38442 100ul
EUR 397

CNTFR alpha Antibody

20-abx225120
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti- CNTFR antibody

FNab01820 100µg
EUR 505.25
  • Immunogen: ciliary neurotrophic factor receptor
  • Uniprot ID: P26992
  • Gene ID: 1271
  • Research Area: Signal Transduction, Cancer, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against CNTFR

Anti-CNTFR antibody

PAab01820 100 ug
EUR 355

Anti-CNTFR antibody

STJ114298 100 µl
EUR 277
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene.

Anti-CNTFR antibody

STJ23187 100 µl
EUR 277
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene.

Anti-CNTFR antibody

STJ71057 100 µg
EUR 359

Anti-CNTFR antibody

STJ190701 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CNTFR

Cntfr/ Rat Cntfr ELISA Kit

ELI-33030r 96 Tests
EUR 886

CNTFR siRNA

20-abx901161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR siRNA

20-abx912312
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR siRNA

20-abx912313
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNTFR Antibody, HRP conjugated

1-CSB-PA005684EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CNTFR Antibody, FITC conjugated

1-CSB-PA005684EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CNTFR Antibody, Biotin conjugated

1-CSB-PA005684ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human CellExp?CNTFR/CNTFR-alpha, human recombinant

7836-10
EUR 245

Human CellExp?CNTFR/CNTFR-alpha, human recombinant

7836-50
EUR 659

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse)

4-PAC185Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR)

CNTFR Blocking Peptide

33R-1094 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AMPH antibody, catalog no. 70R-3809

CNTFR Blocking Peptide

DF7058-BP 1mg
EUR 195

CNTFR cloning plasmid

CSB-CL005684HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atggctgctcctgtcccgtgggcctgctgtgctgtgcttgccgccgccgccgcagttgtctacgcccagagacacagtccacaggaggcaccccatgtgcagtacgagcgcctgggctctgacgtgacactgccatgtgggacagcaaactgggatgctgcggtgacgtggcggg
  • Show more
Description: A cloning plasmid for the CNTFR gene.

pOTB7-CNTFR Plasmid

PVTB00245S 2 ug
EUR 356

Human CNTFR Receptor alpha antibody

32512-05111 150 ug
EUR 261

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse)

4-PAC185Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR)

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC

4-PAC185Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Biotinylated

4-PAC185Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Cy3

4-PAC185Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), FITC

4-PAC185Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), HRP

4-PAC185Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), PE

4-PAC185Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx103900
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx111682
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

20-abx132422
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody

abx332127-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC

4-PAC185Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC185Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC185Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), FITC

4-PAC185Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), HRP

4-PAC185Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), PE

4-PAC185Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE.

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC185Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7.

CNTFR protein (His tag)

80R-4144 100 ug
EUR 327
Description: Recombinant Human CNTFR protein (His tag)

Human CNTFR ELISA Kit

EHC0039 96Tests
EUR 521

Goat CNTFR ELISA Kit

EGTC0039 96Tests
EUR 521

Bovine CNTFR ELISA Kit

EBC0039 96Tests
EUR 521

Canine CNTFR ELISA Kit

ECC0039 96Tests
EUR 521

Chicken CNTFR ELISA Kit

ECKC0039 96Tests
EUR 521

Anserini CNTFR ELISA Kit

EAC0039 96Tests
EUR 521

Canine CNTFR ELISA KIT

ELI-10592d 96 Tests
EUR 928

CNTFR ELISA KIT|Human

EF008771 96 Tests
EUR 689

Rat CNTFR shRNA Plasmid

20-abx989755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CNTFR shRNA Plasmid

20-abx969739
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CNTFR shRNA Plasmid

20-abx950891
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CNTFR ELISA Kit

EMC0039 96Tests
EUR 521

Rat CNTFR ELISA Kit

ERC0039 96Tests
EUR 521

Sheep CNTFR ELISA Kit

ESC0039 96Tests
EUR 521

Monkey CNTFR ELISA Kit

EMKC0039 96Tests
EUR 521

Porcine CNTFR ELISA Kit

EPC0039 96Tests
EUR 521

Human CNTFR ELISA KIT

ELI-33667h 96 Tests
EUR 824

Chicken CNTFR ELISA KIT

ELI-51012c 96 Tests
EUR 928

Mouse Cntfr ELISA KIT

ELI-46855m 96 Tests
EUR 865

Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC185Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CNTFR (Thr120~Leu358)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7.

Human CNTFR Receptor alpha antibody (Biotin Conjugate)

32512-05121 150 ug
EUR 369

Guinea Pig CNTFR ELISA Kit

EGC0039 96Tests
EUR 521

Cntfr ORF Vector (Rat) (pORF)

ORF065230 1.0 ug DNA
EUR 506

CNTFR ORF Vector (Human) (pORF)

ORF002517 1.0 ug DNA
EUR 95

Cntfr ORF Vector (Mouse) (pORF)

ORF041711 1.0 ug DNA
EUR 506

Cntfr ORF Vector (Mouse) (pORF)

ORF041712 1.0 ug DNA
EUR 506

Cntfr ORF Vector (Mouse) (pORF)

ORF041713 1.0 ug DNA
EUR 506

Human CNTFR Receptor alpha AssayLite Antibody (FITC Conjugate)

32512-05141 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (RPE Conjugate)

32512-05151 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (APC Conjugate)

32512-05161 150 ug
EUR 428

Human CNTFR Receptor alpha AssayLite Antibody (PerCP Conjugate)

32512-05171 150 ug
EUR 471

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx037435-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx038395-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx431175-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

20-abx302454
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

abx231820-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody

20-abx002062
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cntfr sgRNA CRISPR Lentivector set (Mouse)

K4998401 3 x 1.0 ug
EUR 339

CNTFR sgRNA CRISPR Lentivector set (Human)

K0478701 3 x 1.0 ug
EUR 339

Cntfr sgRNA CRISPR Lentivector set (Rat)

K7289901 3 x 1.0 ug
EUR 339

Recombinant Ciliary Neurotrophic Factor Receptor (CNTFR)

4-RPC185Hu01
  • EUR 474.53
  • EUR 230.00
  • EUR 1504.48
  • EUR 568.16
  • EUR 1036.32
  • EUR 380.00
  • EUR 3611.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P26992
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.3kDa
  • Isoelectric Point: 6.6
Description: Recombinant Human Ciliary Neurotrophic Factor Receptor expressed in: E.coli

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (HRP)

20-abx303457
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (FITC)

20-abx303458
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (Biotin)

20-abx303459
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Ciliary Neurotrophic Factor Receptor (CNTFR) Protein

20-abx065903
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4998402 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4998403 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4998404 1.0 ug DNA
EUR 154

CNTFR sgRNA CRISPR Lentivector (Human) (Target 1)

K0478702 1.0 ug DNA
EUR 154

CNTFR sgRNA CRISPR Lentivector (Human) (Target 2)

K0478703 1.0 ug DNA
EUR 154

CNTFR sgRNA CRISPR Lentivector (Human) (Target 3)

K0478704 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 1)

K7289902 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 2)

K7289903 1.0 ug DNA
EUR 154

Cntfr sgRNA CRISPR Lentivector (Rat) (Target 3)

K7289904 1.0 ug DNA
EUR 154

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166842 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166843 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166844 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166845 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166846 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166847 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166848 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166849 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-C-His)

PV166850 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPB-N-His)

PV166851 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-HA)

PV166852 500 ng
EUR 603

CNTFR Protein Vector (Mouse) (pPM-C-His)

PV166853 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPB-C-His)

PV260918 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPB-N-His)

PV260919 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPM-C-HA)

PV260920 500 ng
EUR 603

CNTFR Protein Vector (Rat) (pPM-C-His)

PV260921 500 ng
EUR 603

CNTFR Protein Vector (Human) (pPB-C-His)

PV010065 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPB-N-His)

PV010066 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPM-C-HA)

PV010067 500 ng
EUR 329

CNTFR Protein Vector (Human) (pPM-C-His)

PV010068 500 ng
EUR 329

Recombinant Human CNTFR Protein, His, E.coli-1mg

QP11474-1mg 1mg
EUR 2757

Recombinant Human CNTFR Protein, His, E.coli-25ug

QP11474-25ug 25ug
EUR 201

Recombinant Human CNTFR Protein, His, E.coli-5ug

QP11474-5ug 5ug
EUR 155

Recombinant Rat CNTFR Protein, His, Insect-1mg

QP11475-1mg 1mg
EUR 5251

Recombinant Rat CNTFR Protein, His, Insect-20ug

QP11475-20ug 20ug
EUR 201

Recombinant Rat CNTFR Protein, His, Insect-5ug

QP11475-5ug 5ug
EUR 155

Cntfr 3'UTR GFP Stable Cell Line

TU154129 1.0 ml Ask for price

Cntfr 3'UTR Luciferase Stable Cell Line

TU104129 1.0 ml Ask for price

Cntfr 3'UTR Luciferase Stable Cell Line

TU202574 1.0 ml Ask for price

Cntfr 3'UTR GFP Stable Cell Line

TU252574 1.0 ml Ask for price

CNTFR 3'UTR GFP Stable Cell Line

TU054721 1.0 ml
EUR 1521

CNTFR 3'UTR Luciferase Stable Cell Line

TU004721 1.0 ml
EUR 1521

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody

ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody

ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody

ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody

ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

HSP90Alpha Rabbit Polyclonal Antibody

ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

JAK1 Rabbit Polyclonal Antibody

ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK1 Rabbit Polyclonal Antibody

ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

JAK2 Rabbit Polyclonal Antibody

ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JAK2 Rabbit Polyclonal Antibody

ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK2 Rabbit Polyclonal Antibody

ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

JNK3 Rabbit Polyclonal Antibody

ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

CNTFR Rabbit Polyclonal Antibody