CNTFR Rabbit Polyclonal Antibody
CNTFR Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
CNTFR Polyclonal Antibody |
ABP58211-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein |
CNTFR Polyclonal Antibody |
A50133 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
CNTFR Polyclonal Antibody |
ES9543-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CNTFR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CNTFR Polyclonal Antibody |
ES9543-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CNTFR from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CNTFR Rabbit pAb |
A12424-100ul |
Abclonal |
100 ul |
EUR 308 |
CNTFR Rabbit pAb |
A12424-200ul |
Abclonal |
200 ul |
EUR 459 |
CNTFR Rabbit pAb |
A12424-20ul |
Abclonal |
20 ul |
EUR 183 |
CNTFR Rabbit pAb |
A12424-50ul |
Abclonal |
50 ul |
EUR 223 |
CNTFR Rabbit pAb |
A2700-100ul |
Abclonal |
100 ul |
EUR 308 |
CNTFR Rabbit pAb |
A2700-200ul |
Abclonal |
200 ul |
EUR 459 |
CNTFR Rabbit pAb |
A2700-20ul |
Abclonal |
20 ul |
EUR 183 |
CNTFR Rabbit pAb |
A2700-50ul |
Abclonal |
50 ul |
EUR 223 |
CNTFR Antibody |
31061-100ul |
SAB |
100ul |
EUR 252 |
CNTFR Antibody |
31061-50ul |
SAB |
50ul |
EUR 187 |
CNTFR antibody |
70R-16487 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CNTFR antibody |
CNTFR antibody |
38442-100ul |
SAB |
100ul |
EUR 252 |
CNTFR Antibody |
1-CSB-PA005684EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200 |
CNTFR Antibody |
1-CSB-PA005684GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CNTFR Antibody |
DF7058 |
Affbiotech |
200ul |
EUR 304 |
Description: CNTFR Antibody detects endogenous levels of total CNTFR. |
CNTFR Antibody |
CSB-PA276708- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
CNTFR Antibody |
CSB-PA276708-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
CNTFR Antibody |
CSB-PA204475- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
CNTFR Antibody |
CSB-PA204475-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
CNTFR antibody |
70R-9962 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal CNTFR antibody |
CNTFR Antibody |
abx332250-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Rabbit CNTFR ELISA Kit |
ERTC0039 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Goat Anti-CNTFR Antibody |
APG03349G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CNTFR . This antibody is tested and proven to work in the following applications: |
CNTFR Polyclonal Antibody, HRP Conjugated |
A50134 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CNTFR Polyclonal Antibody, FITC Conjugated |
A50135 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CNTFR Polyclonal Antibody, Biotin Conjugated |
A50136 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Polyclonal CNTFR antibody - C-terminal region |
APG03229G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNTFR - C-terminal region. This antibody is tested and proven to work in the following applications: |
CNTFR alpha antibody |
20R-2754 |
Fitzgerald |
50 ug |
EUR 281 |
Description: Rabbit polyclonal CNTFR alpha antibody |
CNTFR Conjugated Antibody |
C31061 |
SAB |
100ul |
EUR 397 |
CNTFR Conjugated Antibody |
C38442 |
SAB |
100ul |
EUR 397 |
CNTFR alpha Antibody |
20-abx225120 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
anti- CNTFR antibody |
FNab01820 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: ciliary neurotrophic factor receptor
- Uniprot ID: P26992
- Gene ID: 1271
- Research Area: Signal Transduction, Cancer, Immunology, Developmental biology, Neuroscience
|
Description: Antibody raised against CNTFR |
Anti-CNTFR antibody |
STJ114298 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. |
Anti-CNTFR antibody |
STJ23187 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. |
Anti-CNTFR antibody |
STJ190701 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CNTFR |
CNTFR siRNA |
20-abx901161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNTFR siRNA |
20-abx912312 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNTFR siRNA |
20-abx912313 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNTFR Antibody, HRP conjugated |
1-CSB-PA005684EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CNTFR Antibody, FITC conjugated |
1-CSB-PA005684EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CNTFR Antibody, Biotin conjugated |
1-CSB-PA005684ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human CellExp?CNTFR/CNTFR-alpha, human recombinant |
7836-10 |
Biovision |
|
EUR 245 |
Human CellExp?CNTFR/CNTFR-alpha, human recombinant |
7836-50 |
Biovision |
|
EUR 659 |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse) |
4-PAC185Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR) |
CNTFR Blocking Peptide |
33R-1094 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AMPH antibody, catalog no. 70R-3809 |
CNTFR Blocking Peptide |
DF7058-BP |
Affbiotech |
1mg |
EUR 195 |
CNTFR cloning plasmid |
CSB-CL005684HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1119
- Sequence: atggctgctcctgtcccgtgggcctgctgtgctgtgcttgccgccgccgccgcagttgtctacgcccagagacacagtccacaggaggcaccccatgtgcagtacgagcgcctgggctctgacgtgacactgccatgtgggacagcaaactgggatgctgcggtgacgtggcggg
- Show more
|
Description: A cloning plasmid for the CNTFR gene. |
Human CNTFR Receptor alpha antibody |
32512-05111 |
AssayPro |
150 ug |
EUR 261 |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse) |
4-PAC185Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR) |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC |
4-PAC185Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC185Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Cy3 |
4-PAC185Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), FITC |
4-PAC185Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), HRP |
4-PAC185Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), PE |
4-PAC185Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
20-abx103900 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
20-abx111682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
20-abx132422 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
abx332127-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC |
4-PAC185Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAC185Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAC185Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), FITC |
4-PAC185Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), HRP |
4-PAC185Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), PE |
4-PAC185Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE. |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC185Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7. |
CNTFR protein (His tag) |
80R-4144 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Recombinant Human CNTFR protein (His tag) |
Human CNTFR ELISA Kit |
EHC0039 |
Abclonal |
96Tests |
EUR 521 |
Goat CNTFR ELISA Kit |
EGTC0039 |
Abclonal |
96Tests |
EUR 521 |
Bovine CNTFR ELISA Kit |
EBC0039 |
Abclonal |
96Tests |
EUR 521 |
Canine CNTFR ELISA Kit |
ECC0039 |
Abclonal |
96Tests |
EUR 521 |
Chicken CNTFR ELISA Kit |
ECKC0039 |
Abclonal |
96Tests |
EUR 521 |
Anserini CNTFR ELISA Kit |
EAC0039 |
Abclonal |
96Tests |
EUR 521 |
Rat CNTFR shRNA Plasmid |
20-abx989755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CNTFR shRNA Plasmid |
20-abx969739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CNTFR shRNA Plasmid |
20-abx950891 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CNTFR ELISA Kit |
EMC0039 |
Abclonal |
96Tests |
EUR 521 |
Rat CNTFR ELISA Kit |
ERC0039 |
Abclonal |
96Tests |
EUR 521 |
Sheep CNTFR ELISA Kit |
ESC0039 |
Abclonal |
96Tests |
EUR 521 |
Monkey CNTFR ELISA Kit |
EMKC0039 |
Abclonal |
96Tests |
EUR 521 |
Porcine CNTFR ELISA Kit |
EPC0039 |
Abclonal |
96Tests |
EUR 521 |
Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAC185Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7. |
Human CNTFR Receptor alpha antibody (Biotin Conjugate) |
32512-05121 |
AssayPro |
150 ug |
EUR 369 |
Guinea Pig CNTFR ELISA Kit |
EGC0039 |
Abclonal |
96Tests |
EUR 521 |
Cntfr ORF Vector (Rat) (pORF) |
ORF065230 |
ABM |
1.0 ug DNA |
EUR 506 |
CNTFR ORF Vector (Human) (pORF) |
ORF002517 |
ABM |
1.0 ug DNA |
EUR 95 |
Cntfr ORF Vector (Mouse) (pORF) |
ORF041711 |
ABM |
1.0 ug DNA |
EUR 506 |
Cntfr ORF Vector (Mouse) (pORF) |
ORF041712 |
ABM |
1.0 ug DNA |
EUR 506 |
Cntfr ORF Vector (Mouse) (pORF) |
ORF041713 |
ABM |
1.0 ug DNA |
EUR 506 |
Human CNTFR Receptor alpha AssayLite Antibody (FITC Conjugate) |
32512-05141 |
AssayPro |
150 ug |
EUR 428 |
Human CNTFR Receptor alpha AssayLite Antibody (RPE Conjugate) |
32512-05151 |
AssayPro |
150 ug |
EUR 428 |
Human CNTFR Receptor alpha AssayLite Antibody (APC Conjugate) |
32512-05161 |
AssayPro |
150 ug |
EUR 428 |
Human CNTFR Receptor alpha AssayLite Antibody (PerCP Conjugate) |
32512-05171 |
AssayPro |
150 ug |
EUR 471 |
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
abx037435-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
abx038395-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
abx431175-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
20-abx302454 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
abx231820-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
20-abx002062 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cntfr sgRNA CRISPR Lentivector set (Mouse) |
K4998401 |
ABM |
3 x 1.0 ug |
EUR 339 |
CNTFR sgRNA CRISPR Lentivector set (Human) |
K0478701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cntfr sgRNA CRISPR Lentivector set (Rat) |
K7289901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Ciliary Neurotrophic Factor Receptor (CNTFR) |
4-RPC185Hu01 |
Cloud-Clone |
-
EUR 474.53
-
EUR 230.00
-
EUR 1504.48
-
EUR 568.16
-
EUR 1036.32
-
EUR 380.00
-
EUR 3611.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P26992
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.3kDa
- Isoelectric Point: 6.6
|
Description: Recombinant Human Ciliary Neurotrophic Factor Receptor expressed in: E.coli |
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (HRP) |
20-abx303457 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (FITC) |
20-abx303458 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (Biotin) |
20-abx303459 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Ciliary Neurotrophic Factor Receptor (CNTFR) Protein |
20-abx065903 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4998402 |
ABM |
1.0 ug DNA |
EUR 154 |
Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4998403 |
ABM |
1.0 ug DNA |
EUR 154 |
Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4998404 |
ABM |
1.0 ug DNA |
EUR 154 |
CNTFR sgRNA CRISPR Lentivector (Human) (Target 1) |
K0478702 |
ABM |
1.0 ug DNA |
EUR 154 |
CNTFR sgRNA CRISPR Lentivector (Human) (Target 2) |
K0478703 |
ABM |
1.0 ug DNA |
EUR 154 |
CNTFR sgRNA CRISPR Lentivector (Human) (Target 3) |
K0478704 |
ABM |
1.0 ug DNA |
EUR 154 |
Cntfr sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7289902 |
ABM |
1.0 ug DNA |
EUR 154 |
Cntfr sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7289903 |
ABM |
1.0 ug DNA |
EUR 154 |
Cntfr sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7289904 |
ABM |
1.0 ug DNA |
EUR 154 |
CNTFR Protein Vector (Mouse) (pPB-C-His) |
PV166842 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-N-His) |
PV166843 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-HA) |
PV166844 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-His) |
PV166845 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-C-His) |
PV166846 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-N-His) |
PV166847 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-HA) |
PV166848 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-His) |
PV166849 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-C-His) |
PV166850 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-N-His) |
PV166851 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-HA) |
PV166852 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-His) |
PV166853 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Rat) (pPB-C-His) |
PV260918 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Rat) (pPB-N-His) |
PV260919 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Rat) (pPM-C-HA) |
PV260920 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Rat) (pPM-C-His) |
PV260921 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Human) (pPB-C-His) |
PV010065 |
ABM |
500 ng |
EUR 329 |
CNTFR Protein Vector (Human) (pPB-N-His) |
PV010066 |
ABM |
500 ng |
EUR 329 |
CNTFR Protein Vector (Human) (pPM-C-HA) |
PV010067 |
ABM |
500 ng |
EUR 329 |
CNTFR Protein Vector (Human) (pPM-C-His) |
PV010068 |
ABM |
500 ng |
EUR 329 |
Recombinant Human CNTFR Protein, His, E.coli-1mg |
QP11474-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human CNTFR Protein, His, E.coli-25ug |
QP11474-25ug |
EnQuireBio |
25ug |
EUR 201 |
Recombinant Human CNTFR Protein, His, E.coli-5ug |
QP11474-5ug |
EnQuireBio |
5ug |
EUR 155 |
Recombinant Rat CNTFR Protein, His, Insect-1mg |
QP11475-1mg |
EnQuireBio |
1mg |
EUR 5251 |
Recombinant Rat CNTFR Protein, His, Insect-20ug |
QP11475-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Rat CNTFR Protein, His, Insect-5ug |
QP11475-5ug |
EnQuireBio |
5ug |
EUR 155 |
Cntfr 3'UTR GFP Stable Cell Line |
TU154129 |
ABM |
1.0 ml |
Ask for price |
Cntfr 3'UTR Luciferase Stable Cell Line |
TU104129 |
ABM |
1.0 ml |
Ask for price |
Cntfr 3'UTR Luciferase Stable Cell Line |
TU202574 |
ABM |
1.0 ml |
Ask for price |
Cntfr 3'UTR GFP Stable Cell Line |
TU252574 |
ABM |
1.0 ml |
Ask for price |
CNTFR 3'UTR GFP Stable Cell Line |
TU054721 |
ABM |
1.0 ml |
EUR 1521 |
CNTFR 3'UTR Luciferase Stable Cell Line |
TU004721 |
ABM |
1.0 ml |
EUR 1521 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
CNTFR Rabbit Polyclonal Antibody