CNTFR Rabbit Polyclonal Antibody
CNTFR Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 CNTFR Polyclonal Antibody |
|
ABP58211-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein |
CNTFR Polyclonal Antibody |
|
ABP58211-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein |
CNTFR Polyclonal Antibody |
|
ABP58211-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CNTFR protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CNTFR from Human, Mouse, Rat. This CNTFR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNTFR protein |
CNTFR Polyclonal Antibody |
|
A50133 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 CNTFR Rabbit pAb |
|
A12424-100ul |
Abclonal |
100 ul |
EUR 308 |
CNTFR Rabbit pAb |
|
A12424-200ul |
Abclonal |
200 ul |
EUR 459 |
CNTFR Rabbit pAb |
|
A12424-20ul |
Abclonal |
20 ul |
EUR 183 |
CNTFR Rabbit pAb |
|
A12424-50ul |
Abclonal |
50 ul |
EUR 223 |
CNTFR Rabbit pAb |
|
A2700-100ul |
Abclonal |
100 ul |
EUR 308 |
CNTFR Rabbit pAb |
|
A2700-200ul |
Abclonal |
200 ul |
EUR 459 |
CNTFR Rabbit pAb |
|
A2700-20ul |
Abclonal |
20 ul |
EUR 183 |
CNTFR Rabbit pAb |
|
A2700-50ul |
Abclonal |
50 ul |
EUR 223 |
 CNTFR Antibody |
|
abx332250-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
 CNTFR antibody |
|
70R-9962 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal CNTFR antibody |
CNTFR antibody |
|
38442-100ul |
SAB |
100ul |
EUR 252 |
CNTFR Antibody |
|
31061-100ul |
SAB |
100ul |
EUR 252 |
CNTFR Antibody |
|
31061-50ul |
SAB |
50ul |
EUR 187 |
CNTFR antibody |
|
70R-16487 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CNTFR antibody |
CNTFR Antibody |
|
DF7058 |
Affbiotech |
200ul |
EUR 304 |
|
Description: CNTFR Antibody detects endogenous levels of total CNTFR. |
CNTFR Antibody |
|
1-CSB-PA005684EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200, IF:1:50-1:200 |
CNTFR Antibody |
|
1-CSB-PA005684GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CNTFR Antibody |
|
CSB-PA276708- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
CNTFR Antibody |
|
CSB-PA276708-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
CNTFR Antibody |
|
CSB-PA204475- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
CNTFR Antibody |
|
CSB-PA204475-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 0.5mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.3, 0.05% sodium azide and 50% glycerol. Affinity purification
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:2000 |
 Rabbit CNTFR ELISA Kit |
|
ERTC0039 |
Abclonal |
96Tests |
EUR 521 |
 Polyclonal Goat Anti-CNTFR Antibody |
|
APG03349G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CNTFR . This antibody is tested and proven to work in the following applications: |
 CNTFR Polyclonal Antibody, HRP Conjugated |
|
A50134 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 CNTFR Polyclonal Antibody, FITC Conjugated |
|
A50135 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: fast delivery possible |
 CNTFR Polyclonal Antibody, Biotin Conjugated |
|
A50136 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 Polyclonal CNTFR antibody - C-terminal region |
|
APG03229G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNTFR - C-terminal region. This antibody is tested and proven to work in the following applications: |
 CNTFR Conjugated Antibody |
|
C38442 |
SAB |
100ul |
EUR 397 |
CNTFR Conjugated Antibody |
|
C31061 |
SAB |
100ul |
EUR 397 |
 anti- CNTFR antibody |
|
FNab01820 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: ciliary neurotrophic factor receptor
- Uniprot ID: P26992
- Gene ID: 1271
- Research Area: Signal Transduction, Cancer, Immunology, Developmental biology, Neuroscience
|
|
Description: Antibody raised against CNTFR |
 CNTFR alpha Antibody |
|
20-abx225120 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
 CNTFR alpha antibody |
|
20R-2754 |
Fitzgerald |
50 ug |
EUR 281 |
|
Description: Rabbit polyclonal CNTFR alpha antibody |
 Anti-CNTFR antibody |
|
STJ23187 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. |
Anti-CNTFR antibody |
|
STJ114298 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a member of the type 1 cytokine receptor family. The encoded protein is the ligand-specific component of a tripartite receptor for ciliary neurotrophic factor, which plays a critical role in neuronal cell survival, differentiation and gene expression. Binding of ciliary neurotrophic factor to the encoded protein recruits the transmembrane components of the receptor, gp130 and leukemia inhibitory factor receptor, facilitating signal transduction. Single nucleotide polymorphisms in this gene may be associated with variations in muscle strength, as well as early onset of eating disorders. Alternatively spliced transcript variants have been observed for this gene. |
Anti-CNTFR antibody |
|
STJ190701 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to CNTFR |
 CNTFR siRNA |
|
20-abx901161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNTFR siRNA |
|
20-abx912312 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CNTFR siRNA |
|
20-abx912313 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CNTFR Antibody, HRP conjugated |
|
1-CSB-PA005684EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CNTFR Antibody, FITC conjugated |
|
1-CSB-PA005684EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CNTFR Antibody, Biotin conjugated |
|
1-CSB-PA005684ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CNTFR. Recognizes CNTFR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 Human CellExp?CNTFR/CNTFR-alpha, human recombinant |
|
7836-10 |
Biovision |
|
EUR 245 |
Human CellExp?CNTFR/CNTFR-alpha, human recombinant |
|
7836-50 |
Biovision |
|
EUR 659 |
 Polyclonal Antibody (Mouse)) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse) |
|
4-PAC185Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR) |
 CNTFR cloning plasmid |
|
CSB-CL005684HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1119
- Sequence: atggctgctcctgtcccgtgggcctgctgtgctgtgcttgccgccgccgccgcagttgtctacgcccagagacacagtccacaggaggcaccccatgtgcagtacgagcgcctgggctctgacgtgacactgccatgtgggacagcaaactgggatgctgcggtgacgtggcggg
- Show more
|
|
Description: A cloning plasmid for the CNTFR gene. |
 CNTFR Blocking Peptide |
|
33R-1094 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AMPH antibody, catalog no. 70R-3809 |
CNTFR Blocking Peptide |
|
DF7058-BP |
Affbiotech |
1mg |
EUR 195 |
 Human CNTFR Receptor alpha antibody |
|
32512-05111 |
AssayPro |
150 ug |
EUR 261 |
 Polyclonal Antibody (Human, Mouse)) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse) |
|
4-PAC185Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR) |
 Polyclonal Antibody (Mouse), APC) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC |
|
4-PAC185Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAC185Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAC185Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), FITC |
|
4-PAC185Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), HRP |
|
4-PAC185Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), PE |
|
4-PAC185Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE. |
 Antibody) Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
|
20-abx111682 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
|
20-abx132422 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
|
20-abx103900 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Ciliary Neurotrophic Factor Receptor (CNTFR) Antibody |
|
abx332127-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
 Polyclonal Antibody (Human, Mouse), APC) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC |
|
4-PAC185Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Mouse), Biotinylated) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Biotinylated |
|
4-PAC185Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Mouse), Cy3) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), Cy3 |
|
4-PAC185Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Mouse), FITC) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), FITC |
|
4-PAC185Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Mouse), HRP) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), HRP |
|
4-PAC185Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Mouse), PE) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), PE |
|
4-PAC185Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with PE. |
 Polyclonal Antibody (Mouse), APC-Cy7) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAC185Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Inquire for antigen sequence.
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7. |
 Rat CNTFR shRNA Plasmid |
|
20-abx989755 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CNTFR ELISA Kit |
|
EHC0039 |
Abclonal |
96Tests |
EUR 521 |
 Goat CNTFR ELISA Kit |
|
EGTC0039 |
Abclonal |
96Tests |
EUR 521 |
 Canine CNTFR ELISA Kit |
|
ECC0039 |
Abclonal |
96Tests |
EUR 521 |
 Chicken CNTFR ELISA Kit |
|
ECKC0039 |
Abclonal |
96Tests |
EUR 521 |
 Bovine CNTFR ELISA Kit |
|
EBC0039 |
Abclonal |
96Tests |
EUR 521 |
 Anserini CNTFR ELISA Kit |
|
EAC0039 |
Abclonal |
96Tests |
EUR 521 |
 Rat CNTFR ELISA Kit |
|
ERC0039 |
Abclonal |
96Tests |
EUR 521 |
 Sheep CNTFR ELISA Kit |
|
ESC0039 |
Abclonal |
96Tests |
EUR 521 |
 Porcine CNTFR ELISA Kit |
|
EPC0039 |
Abclonal |
96Tests |
EUR 521 |
 Mouse CNTFR ELISA Kit |
|
EMC0039 |
Abclonal |
96Tests |
EUR 521 |
 Monkey CNTFR ELISA Kit |
|
EMKC0039 |
Abclonal |
96Tests |
EUR 521 |
 Human CNTFR shRNA Plasmid |
|
20-abx950891 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CNTFR protein (His tag) |
|
80R-4144 |
Fitzgerald |
100 ug |
EUR 327 |
|
Description: Recombinant Human CNTFR protein (His tag) |
 Mouse CNTFR shRNA Plasmid |
|
20-abx969739 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Polyclonal Antibody (Human, Mouse), APC-Cy7) Ciliary Neurotrophic Factor Receptor (CNTFR) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
|
4-PAC185Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CNTFR (Thr120~Leu358)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Mouse Ciliary Neurotrophic Factor Receptor (CNTFR). This antibody is labeled with APC-Cy7. |
) Human CNTFR Receptor alpha antibody (Biotin Conjugate) |
|
32512-05121 |
AssayPro |
150 ug |
EUR 369 |
 Guinea Pig CNTFR ELISA Kit |
|
EGC0039 |
Abclonal |
96Tests |
EUR 521 |
 (pORF)) CNTFR ORF Vector (Human) (pORF) |
|
ORF002517 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Cntfr ORF Vector (Rat) (pORF) |
|
ORF065230 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Cntfr ORF Vector (Mouse) (pORF) |
|
ORF041711 |
ABM |
1.0 ug DNA |
EUR 506 |
Cntfr ORF Vector (Mouse) (pORF) |
|
ORF041712 |
ABM |
1.0 ug DNA |
EUR 506 |
Cntfr ORF Vector (Mouse) (pORF) |
|
ORF041713 |
ABM |
1.0 ug DNA |
EUR 506 |
 Antibody) Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
20-abx002062 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
abx037435-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
abx038395-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
abx431175-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
20-abx302454 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody |
|
abx231820-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
) Human CNTFR Receptor alpha AssayLite Antibody (FITC Conjugate) |
|
32512-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human CNTFR Receptor alpha AssayLite Antibody (RPE Conjugate) |
|
32512-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human CNTFR Receptor alpha AssayLite Antibody (APC Conjugate) |
|
32512-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human CNTFR Receptor alpha AssayLite Antibody (PerCP Conjugate) |
|
32512-05171 |
AssayPro |
150 ug |
EUR 471 |
) CNTFR sgRNA CRISPR Lentivector set (Human) |
|
K0478701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cntfr sgRNA CRISPR Lentivector set (Mouse) |
|
K4998401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Cntfr sgRNA CRISPR Lentivector set (Rat) |
|
K7289901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant Ciliary Neurotrophic Factor Receptor (CNTFR) |
|
4-RPC185Hu01 |
Cloud-Clone |
-
EUR 474.53
-
EUR 230.00
-
EUR 1504.48
-
EUR 568.16
-
EUR 1036.32
-
EUR 380.00
-
EUR 3611.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P26992
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 30.3kDa
- Isoelectric Point: 6.6
|
|
Description: Recombinant Human Ciliary Neurotrophic Factor Receptor expressed in: E.coli |
 Antibody (HRP)) Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (HRP) |
|
20-abx303457 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (FITC) |
|
20-abx303458 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Ciliary Neurotrophic Factor Receptor Subunit Alpha (CNTFR) Antibody (Biotin) |
|
20-abx303459 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) CNTFR sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0478702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) CNTFR sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0478703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) CNTFR sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0478704 |
ABM |
1.0 ug DNA |
EUR 154 |
 Protein) Human Ciliary Neurotrophic Factor Receptor (CNTFR) Protein |
|
20-abx065903 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2026.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4998402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4998403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cntfr sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4998404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Cntfr sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7289902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cntfr sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7289903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cntfr sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7289904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CNTFR Protein Vector (Mouse) (pPB-C-His) |
|
PV166842 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CNTFR Protein Vector (Mouse) (pPB-N-His) |
|
PV166843 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CNTFR Protein Vector (Mouse) (pPM-C-HA) |
|
PV166844 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CNTFR Protein Vector (Mouse) (pPM-C-His) |
|
PV166845 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-C-His) |
|
PV166846 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-N-His) |
|
PV166847 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-HA) |
|
PV166848 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-His) |
|
PV166849 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-C-His) |
|
PV166850 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPB-N-His) |
|
PV166851 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-HA) |
|
PV166852 |
ABM |
500 ng |
EUR 603 |
CNTFR Protein Vector (Mouse) (pPM-C-His) |
|
PV166853 |
ABM |
500 ng |
EUR 603 |
 Recombinant Human CNTFR Protein, His, E.coli-1mg |
|
QP11474-1mg |
EnQuireBio |
1mg |
EUR 2757 |
 Recombinant Human CNTFR Protein, His, E.coli-25ug |
|
QP11474-25ug |
EnQuireBio |
25ug |
EUR 201 |
 Recombinant Human CNTFR Protein, His, E.coli-5ug |
|
QP11474-5ug |
EnQuireBio |
5ug |
EUR 155 |
 Recombinant Rat CNTFR Protein, His, Insect-1mg |
|
QP11475-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Rat CNTFR Protein, His, Insect-20ug |
|
QP11475-20ug |
EnQuireBio |
20ug |
EUR 201 |
 Recombinant Rat CNTFR Protein, His, Insect-5ug |
|
QP11475-5ug |
EnQuireBio |
5ug |
EUR 155 |
 (pPB-C-His)) CNTFR Protein Vector (Human) (pPB-C-His) |
|
PV010065 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) CNTFR Protein Vector (Human) (pPB-N-His) |
|
PV010066 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) CNTFR Protein Vector (Human) (pPM-C-HA) |
|
PV010067 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) CNTFR Protein Vector (Human) (pPM-C-His) |
|
PV010068 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) CNTFR Protein Vector (Rat) (pPB-C-His) |
|
PV260918 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) CNTFR Protein Vector (Rat) (pPB-N-His) |
|
PV260919 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) CNTFR Protein Vector (Rat) (pPM-C-HA) |
|
PV260920 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) CNTFR Protein Vector (Rat) (pPM-C-His) |
|
PV260921 |
ABM |
500 ng |
EUR 603 |
 Cntfr 3'UTR Luciferase Stable Cell Line |
|
TU202574 |
ABM |
1.0 ml |
Ask for price |
 Cntfr 3'UTR GFP Stable Cell Line |
|
TU154129 |
ABM |
1.0 ml |
Ask for price |
 CNTFR 3'UTR Luciferase Stable Cell Line |
|
TU004721 |
ABM |
1.0 ml |
EUR 1521 |
Cntfr 3'UTR Luciferase Stable Cell Line |
|
TU104129 |
ABM |
1.0 ml |
Ask for price |
 CNTFR 3'UTR GFP Stable Cell Line |
|
TU054721 |
ABM |
1.0 ml |
EUR 1521 |
Cntfr 3'UTR GFP Stable Cell Line |
|
TU252574 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CNTFR Rabbit Polyclonal Antibody
