DCTN4 Rabbit Polyclonal Antibody
DCTN4 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
DCTN4 Polyclonal Antibody |
ABP58337-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DCTN4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DCTN4 from Human, Mouse, Rat. This DCTN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DCTN4 protein |
DCTN4 Polyclonal Antibody |
ABP58337-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DCTN4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DCTN4 from Human, Mouse, Rat. This DCTN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DCTN4 protein |
DCTN4 Polyclonal Antibody |
A58734 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
DCTN4 Polyclonal Antibody |
ES9615-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DCTN4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DCTN4 Polyclonal Antibody |
ES9615-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DCTN4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DCTN4 antibody |
70R-16762 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DCTN4 antibody |
DCTN4 Antibody |
36404-100ul |
SAB |
100ul |
EUR 252 |
DCTN4 antibody |
10R-1706 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal DCTN4 antibody |
DCTN4 Antibody |
1-CSB-PA892445LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
DCTN4 Antibody |
DF9468 |
Affbiotech |
200ul |
EUR 304 |
Description: DCTN4 Antibody detects endogenous levels of total DCTN4. |
DCTN4 Antibody |
1-CSB-PA561781 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
DCTN4 Antibody |
1-CSB-PA034013 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300 |
DCTN4 Antibody |
1-CSB-PA006567GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DCTN4 Polyclonal Antibody, Biotin Conjugated |
A58735 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
DCTN4 Polyclonal Antibody, FITC Conjugated |
A58736 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
DCTN4 Polyclonal Antibody, HRP Conjugated |
A58737 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DCTN4 Conjugated Antibody |
C36404 |
SAB |
100ul |
EUR 397 |
anti- DCTN4 antibody |
FNab02274 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: dynactin 4(p62)
- Uniprot ID: Q9UJW0
- Gene ID: 51164
- Research Area: Signal Transduction
|
Description: Antibody raised against DCTN4 |
Anti-DCTN4 antibody |
STJ190773 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DCTN4 |
DCTN4 siRNA |
20-abx901439 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCTN4 siRNA |
20-abx913701 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCTN4 siRNA |
20-abx913702 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DCTN4 Antibody, HRP conjugated |
1-CSB-PA892445LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DCTN4 Antibody, FITC conjugated |
1-CSB-PA892445LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DCTN4 Antibody, Biotin conjugated |
1-CSB-PA892445LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DCTN4 cloning plasmid |
CSB-CL892445HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1383
- Sequence: atggcgtccttgctgcagtcggaccgggttctctatctagtccagggagaaaagaaggttcgggccccgctctcgcaactctacttctgccgctattgtagcgaactgcggtcgctggaatgtgtgtctcacgaggtggactcccattattgtcccagttgtttagaaaatatgc
- Show more
|
Description: A cloning plasmid for the DCTN4 gene. |
DCTN4 Blocking Peptide |
DF9468-BP |
Affbiotech |
1mg |
EUR 195 |
Dynactin Subunit 4 (DCTN4) Antibody |
abx027400-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
abx027400-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
abx015834-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
abx015835-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
20-abx214839 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
20-abx112189 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
20-abx241497 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal DCTN4 Antibody, Clone: 3G9D7 |
APR15705G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human DCTN4. The antibodies are raised in Mouse and are from clone 3G9D7. This antibody is applicable in WB and IHC, FC, ICC, E |
Monoclonal DCTN4 Antibody, Clone: 3G9D7 |
APR15706G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human DCTN4. The antibodies are raised in Mouse and are from clone 3G9D7. This antibody is applicable in WB and IHC, FC, ICC, E |
Dynactin Subunit 4 (DCTN4) Antibody |
20-abx318035 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody |
abx232274-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Mouse DCTN4 shRNA Plasmid |
20-abx976253 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat DCTN4 shRNA Plasmid |
20-abx986939 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DCTN4 shRNA Plasmid |
20-abx959575 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DCTN4 Recombinant Protein (Human) |
RP008863 |
ABM |
100 ug |
Ask for price |
DCTN4 Recombinant Protein (Rat) |
RP197495 |
ABM |
100 ug |
Ask for price |
DCTN4 Recombinant Protein (Mouse) |
RP128186 |
ABM |
100 ug |
Ask for price |
Dynactin Subunit 4 (DCTN4) Antibody (HRP) |
20-abx312302 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody (FITC) |
20-abx312303 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Dynactin Subunit 4 (DCTN4) Antibody (Biotin) |
20-abx312304 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Dynactin subunit 4 (DCTN4) |
1-CSB-YP892445HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 54.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Dynactin subunit 4(DCTN4) expressed in Yeast |
Dctn4 ORF Vector (Rat) (pORF) |
ORF065833 |
ABM |
1.0 ug DNA |
EUR 506 |
DCTN4 ORF Vector (Human) (pORF) |
ORF002955 |
ABM |
1.0 ug DNA |
EUR 95 |
Dctn4 ORF Vector (Mouse) (pORF) |
ORF042730 |
ABM |
1.0 ug DNA |
EUR 506 |
Human Dynactin 4 (DCTN4)ELISA Kit |
201-12-2662 |
SunredBio |
96 tests |
EUR 440 |
- This Dynactin 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
DCTN4 sgRNA CRISPR Lentivector set (Human) |
K0567501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dctn4 sgRNA CRISPR Lentivector set (Rat) |
K7034901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dctn4 sgRNA CRISPR Lentivector set (Mouse) |
K3464001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Dynactin Subunit 4 (DCTN4) ELISA Kit |
abx386812-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
DCTN4 Rabbit Polyclonal Antibody