DCTN4 Rabbit Polyclonal Antibody

DCTN4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

DCTN4 Polyclonal Antibody
ABP58337-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DCTN4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DCTN4 from Human, Mouse, Rat. This DCTN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DCTN4 protein
DCTN4 Polyclonal Antibody
ABP58337-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DCTN4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DCTN4 from Human, Mouse, Rat. This DCTN4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DCTN4 protein
DCTN4 Polyclonal Antibody
A58734 100 µg
EUR 570.55
Description: reagents widely cited
DCTN4 Polyclonal Antibody
ES9615-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DCTN4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DCTN4 Polyclonal Antibody
ES9615-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DCTN4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DCTN4 antibody
70R-16762 50 ul
EUR 435
Description: Rabbit polyclonal DCTN4 antibody
DCTN4 Antibody
36404-100ul 100ul
EUR 252
DCTN4 antibody
10R-1706 100 ug
EUR 512
Description: Mouse monoclonal DCTN4 antibody
DCTN4 Antibody
1-CSB-PA892445LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
DCTN4 Antibody
DF9468 200ul
EUR 304
Description: DCTN4 Antibody detects endogenous levels of total DCTN4.
DCTN4 Antibody
1-CSB-PA561781
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
DCTN4 Antibody
1-CSB-PA034013
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
DCTN4 Antibody
1-CSB-PA006567GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
DCTN4 Antibody
ABD9468 100 ug
EUR 438
DCTN4 Polyclonal Antibody, Biotin Conjugated
A58735 100 µg
EUR 570.55
Description: Ask the seller for details
DCTN4 Polyclonal Antibody, FITC Conjugated
A58736 100 µg
EUR 570.55
Description: The best epigenetics products
DCTN4 Polyclonal Antibody, HRP Conjugated
A58737 100 µg
EUR 570.55
Description: kits suitable for this type of research
Dctn4/ Rat Dctn4 ELISA Kit
ELI-07880r 96 Tests
EUR 886
DCTN4 Conjugated Antibody
C36404 100ul
EUR 397
anti- DCTN4 antibody
FNab02274 100µg
EUR 505.25
  • Immunogen: dynactin 4(p62)
  • Uniprot ID: Q9UJW0
  • Gene ID: 51164
  • Research Area: Signal Transduction
Description: Antibody raised against DCTN4
Anti-DCTN4 antibody
PAab02274 100 ug
EUR 355
Anti-DCTN4 antibody
STJ190773 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DCTN4
DCTN4 siRNA
20-abx901439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DCTN4 siRNA
20-abx913701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DCTN4 siRNA
20-abx913702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DCTN4 Antibody, HRP conjugated
1-CSB-PA892445LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DCTN4 Antibody, FITC conjugated
1-CSB-PA892445LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DCTN4 Antibody, Biotin conjugated
1-CSB-PA892445LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCTN4. Recognizes DCTN4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
DCTN4 cloning plasmid
CSB-CL892445HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1383
  • Sequence: atggcgtccttgctgcagtcggaccgggttctctatctagtccagggagaaaagaaggttcgggccccgctctcgcaactctacttctgccgctattgtagcgaactgcggtcgctggaatgtgtgtctcacgaggtggactcccattattgtcccagttgtttagaaaatatgc
  • Show more
Description: A cloning plasmid for the DCTN4 gene.
DCTN4 Blocking Peptide
DF9468-BP 1mg
EUR 195
pBluescriptR-DCTN4 Plasmid
PVT15837 2 ug
EUR 325
Dynactin Subunit 4 (DCTN4) Antibody
abx027400-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
abx027400-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
abx015834-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
abx015835-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
20-abx214839
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
20-abx112189
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
20-abx241497
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Monoclonal DCTN4 Antibody, Clone: 3G9D7
APR15705G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human DCTN4. The antibodies are raised in Mouse and are from clone 3G9D7. This antibody is applicable in WB and IHC, FC, ICC, E
Monoclonal DCTN4 Antibody, Clone: 3G9D7
APR15706G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human DCTN4. The antibodies are raised in Mouse and are from clone 3G9D7. This antibody is applicable in WB and IHC, FC, ICC, E
Dynactin Subunit 4 (DCTN4) Antibody
20-abx318035
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody
abx232274-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
DCTN4 ELISA KIT|Human
EF009030 96 Tests
EUR 689
Mouse DCTN4 shRNA Plasmid
20-abx976253
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat DCTN4 shRNA Plasmid
20-abx986939
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DCTN4 shRNA Plasmid
20-abx959575
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DCTN4 Recombinant Protein (Human)
RP008863 100 ug Ask for price
DCTN4 Recombinant Protein (Rat)
RP197495 100 ug Ask for price
DCTN4 Recombinant Protein (Mouse)
RP128186 100 ug Ask for price
Dynactin Subunit 4 (DCTN4) Antibody (HRP)
20-abx312302
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody (FITC)
20-abx312303
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dynactin Subunit 4 (DCTN4) Antibody (Biotin)
20-abx312304
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Dynactin subunit 4 (DCTN4)
1-CSB-YP892445HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Dynactin subunit 4(DCTN4) expressed in Yeast
Dctn4 ORF Vector (Rat) (pORF)
ORF065833 1.0 ug DNA
EUR 506
DCTN4 ORF Vector (Human) (pORF)
ORF002955 1.0 ug DNA
EUR 95
Dctn4 ORF Vector (Mouse) (pORF)
ORF042730 1.0 ug DNA
EUR 506
Human Dynactin 4 (DCTN4)ELISA Kit
201-12-2662 96 tests
EUR 440
  • This Dynactin 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
DCTN4 sgRNA CRISPR Lentivector set (Human)
K0567501 3 x 1.0 ug
EUR 339
Dctn4 sgRNA CRISPR Lentivector set (Rat)
K7034901 3 x 1.0 ug
EUR 339
Dctn4 sgRNA CRISPR Lentivector set (Mouse)
K3464001 3 x 1.0 ug
EUR 339
Human Dynactin 4(DCTN4)ELISA Kit
QY-E03779 96T
EUR 361
Mouse Dynactin subunit 4, Dctn4 ELISA KIT
ELI-28142m 96 Tests
EUR 865
Human Dynactin Subunit 4 (DCTN4) ELISA Kit
abx386812-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

DCTN4 Rabbit Polyclonal Antibody