DDX42 Rabbit Polyclonal Antibody
DDX42 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
DDX42 Polyclonal Antibody |
ABP58345-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930
- Applications tips:
|
Description: A polyclonal antibody for detection of DDX42 from Human, Mouse. This DDX42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930 |
DDX42 Polyclonal Antibody |
ABP58345-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930
- Applications tips:
|
Description: A polyclonal antibody for detection of DDX42 from Human, Mouse. This DDX42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930 |
DDX42 Polyclonal Antibody |
A58750 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DDX42 antibody |
70R-4789 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DDX42 antibody |
DDX42 Antibody |
45795-100ul |
SAB |
100ul |
EUR 252 |
DDX42 Antibody |
45795-50ul |
SAB |
50ul |
EUR 187 |
DDX42 Antibody |
47040-100ul |
SAB |
100ul |
EUR 252 |
DDX42 Antibody |
DF9259 |
Affbiotech |
200ul |
EUR 304 |
Description: DDX42 Antibody detects endogenous levels of total DDX42. |
DDX42 Antibody |
1-CSB-PA773053LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500 |
DDX42 Polyclonal Antibody, Biotin Conjugated |
A58751 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
DDX42 Polyclonal Antibody, FITC Conjugated |
A58752 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
DDX42 Polyclonal Antibody, HRP Conjugated |
A58753 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E04A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E04A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E04A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody |
20-abx148445 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody |
20-abx301470 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DDX42 Conjugated Antibody |
C45795 |
SAB |
100ul |
EUR 397 |
DDX42 Conjugated Antibody |
C47040 |
SAB |
100ul |
EUR 397 |
Anti-DDX42 antibody |
STJ190593 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DDX42 |
ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (HRP) |
20-abx308343 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (FITC) |
20-abx308344 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (Biotin) |
20-abx308345 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DDX42 siRNA |
20-abx913807 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DDX42 siRNA |
20-abx913808 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DDX42 |
YF-PA17593 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DDX42 |
DDX42 Antibody, HRP conjugated |
1-CSB-PA773053LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DDX42 Antibody, FITC conjugated |
1-CSB-PA773053LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DDX42 Antibody, Biotin conjugated |
1-CSB-PA773053LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
DDX42 Blocking Peptide |
33R-7187 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX42 antibody, catalog no. 70R-4789 |
DDX42 Blocking Peptide |
DF9259-BP |
Affbiotech |
1mg |
EUR 195 |
DDX42 cloning plasmid |
CSB-CL773053HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2460
- Sequence: atggctgaagtggaggatcaggcagctagagacatgaagaggcttgaagaaaaggacaaggaaagaaaaaacgtaaagggtattcgagatgacattgaagaggaagatgaccaagaagcttattttcgatacatggcagaaaacccaactgctggtgtggttcaggaggaagagg
- Show more
|
Description: A cloning plasmid for the DDX42 gene. |
Chicken ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit |
abx517113-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit |
abx517115-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human DDX42/ ATP-dependent RNA helicase DDX42 ELISA Kit |
E0672Hu |
Sunlong |
1 Kit |
EUR 605 |
Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E06A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E06A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E06A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E01A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E01A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E01A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E03A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E03A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E03A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Ddx42/ ATP-dependent RNA helicase DDX42 ELISA Kit |
E0386Mo |
Sunlong |
1 Kit |
EUR 632 |
Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E02A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E02A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E02A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E07A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E07A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E07A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E09A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E09A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E09A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E08A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E08A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E08A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human DDX42(ATP-dependent RNA helicase DDX42) ELISA Kit |
EH1652 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 78-5000 pg/ml
- Uniprot ID: Q86XP3
- Alias: DDX42/ATP-dependent RNA helicase DDX42/Splicing factor 3B-associated 125 kDa protein/SF3b125/SF3b DEAD box protein/RNA helicase-related protein/RNAHP/DEAD box protein 42/RNA helicase-like prote
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml |
Mouse ATP- dependent RNA helicase DDX42, Ddx42 ELISA KIT |
ELI-26533m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken ATP- dependent RNA helicase DDX42, DDX42 ELISA KIT |
ELI-46923c |
Lifescience Market |
96 Tests |
EUR 928 |
Human ATP- dependent RNA helicase DDX42, DDX42 ELISA KIT |
ELI-31038h |
Lifescience Market |
96 Tests |
EUR 824 |
Human ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit |
abx250947-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E05A1834-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E05A1834-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit |
E05A1834-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
DDX42 ELISA Kit| chicken ATP-dependent RNA helicase DDX42 ELISA |
EF012271 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse DDX42 shRNA Plasmid |
20-abx977645 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DDX42 shRNA Plasmid |
20-abx957753 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Ddx42 ELISA Kit| Mouse ATP-dependent RNA helicase DDX42 ELISA K |
EF014639 |
Lifescience Market |
96 Tests |
EUR 689 |
DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 (DDX42) polyclonal antibody |
ABP-PAB-02241 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Apoptosis
- Brand:
|
DDX42 ORF Vector (Human) (pORF) |
ORF003006 |
ABM |
1.0 ug DNA |
EUR 95 |
Ddx42 ORF Vector (Rat) (pORF) |
ORF065886 |
ABM |
1.0 ug DNA |
EUR 506 |
Ddx42 ORF Vector (Mouse) (pORF) |
ORF042809 |
ABM |
1.0 ug DNA |
EUR 506 |
DDX42 ELISA Kit (Human) (OKEH02374) |
OKEH02374 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL |
DDX42 ELISA Kit (Mouse) (OKEH05469) |
OKEH05469 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: ATP-dependent RNA helicase. Binds to partially double-stranded RNAs (dsRNAs) in order to unwind RNA secondary structures. Unwinding is promoted in the presence of single-strand binding proteins. Mediates also RNA duplex formation thereby displacing the single-strand RNA binding protein. ATP and ADP modulate its activity: ATP binding and hydrolysis by DDX42 triggers RNA strand separation, whereas the ADP-bound form of the protein triggers annealing of complementary RNA strands. Involved in the survival of cells by interacting with TP53BP2 and thereby counteracting the apoptosis-stimulating activity of TP53BP2. Relocalizes TP53BP2 to the cytoplasm.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.78 pg/mL |
DDX42 ELISA Kit (Chicken) (OKEH08050) |
OKEH08050 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
DDX42 sgRNA CRISPR Lentivector set (Human) |
K0574001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ddx42 sgRNA CRISPR Lentivector set (Mouse) |
K4569801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ddx42 sgRNA CRISPR Lentivector set (Rat) |
K6341701 |
ABM |
3 x 1.0 ug |
EUR 339 |
DDX42 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0574002 |
ABM |
1.0 ug DNA |
EUR 154 |
DDX42 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0574003 |
ABM |
1.0 ug DNA |
EUR 154 |
DDX42 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0574004 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4569802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4569803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4569804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6341702 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6341703 |
ABM |
1.0 ug DNA |
EUR 154 |
Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6341704 |
ABM |
1.0 ug DNA |
EUR 154 |
DDX42 Protein Vector (Human) (pPB-C-His) |
PV012021 |
ABM |
500 ng |
EUR 329 |
DDX42 Protein Vector (Human) (pPB-N-His) |
PV012022 |
ABM |
500 ng |
EUR 329 |
DDX42 Protein Vector (Human) (pPM-C-HA) |
PV012023 |
ABM |
500 ng |
EUR 329 |
DDX42 Protein Vector (Human) (pPM-C-His) |
PV012024 |
ABM |
500 ng |
EUR 329 |
DDX42 Protein Vector (Mouse) (pPB-C-His) |
PV171234 |
ABM |
500 ng |
EUR 1065 |
DDX42 Protein Vector (Mouse) (pPB-N-His) |
PV171235 |
ABM |
500 ng |
EUR 1065 |
DDX42 Protein Vector (Mouse) (pPM-C-HA) |
PV171236 |
ABM |
500 ng |
EUR 1065 |
DDX42 Protein Vector (Mouse) (pPM-C-His) |
PV171237 |
ABM |
500 ng |
EUR 1065 |
DDX42 Protein Vector (Rat) (pPB-C-His) |
PV263542 |
ABM |
500 ng |
EUR 1191 |
DDX42 Protein Vector (Rat) (pPB-N-His) |
PV263543 |
ABM |
500 ng |
EUR 1191 |
DDX42 Protein Vector (Rat) (pPM-C-HA) |
PV263544 |
ABM |
500 ng |
EUR 1191 |
DDX42 Protein Vector (Rat) (pPM-C-His) |
PV263545 |
ABM |
500 ng |
EUR 1191 |
Ddx42 3'UTR Luciferase Stable Cell Line |
TU203265 |
ABM |
1.0 ml |
Ask for price |
Ddx42 3'UTR GFP Stable Cell Line |
TU154971 |
ABM |
1.0 ml |
Ask for price |
DDX42 3'UTR Luciferase Stable Cell Line |
TU005719 |
ABM |
1.0 ml |
EUR 1394 |
Ddx42 3'UTR Luciferase Stable Cell Line |
TU104971 |
ABM |
1.0 ml |
Ask for price |
DDX42 3'UTR GFP Stable Cell Line |
TU055719 |
ABM |
1.0 ml |
EUR 1394 |
Ddx42 3'UTR GFP Stable Cell Line |
TU253265 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
DDX42 Rabbit Polyclonal Antibody