DDX42 Rabbit Polyclonal Antibody

DDX42 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

DDX42 Polyclonal Antibody

ABP58345-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of DDX42 from Human, Mouse. This DDX42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930

DDX42 Polyclonal Antibody

ABP58345-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930
  • Applications tips:
Description: A polyclonal antibody for detection of DDX42 from Human, Mouse. This DDX42 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX42 protein at amino acid sequence of 850-930

DDX42 Polyclonal Antibody

A58750 100 µg
EUR 570.55
Description: kits suitable for this type of research

DDX42 Antibody

ABD9259 100 ug
EUR 438

DDX42 antibody

70R-4789 50 ug
EUR 467
Description: Rabbit polyclonal DDX42 antibody

DDX42 Antibody

45795-100ul 100ul
EUR 252

DDX42 Antibody

45795-50ul 50ul
EUR 187

DDX42 Antibody

47040-100ul 100ul
EUR 252

DDX42 Antibody

DF9259 200ul
EUR 304
Description: DDX42 Antibody detects endogenous levels of total DDX42.

DDX42 Antibody

1-CSB-PA773053LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500

DDX42 Polyclonal Antibody, Biotin Conjugated

A58751 100 µg
EUR 570.55
Description: fast delivery possible

DDX42 Polyclonal Antibody, FITC Conjugated

A58752 100 µg
EUR 570.55
Description: reagents widely cited

DDX42 Polyclonal Antibody, HRP Conjugated

A58753 100 µg
EUR 570.55
Description: Ask the seller for details

Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E04A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E04A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E04A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody

20-abx148445
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody

20-abx301470
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DDX42 Conjugated Antibody

C45795 100ul
EUR 397

DDX42 Conjugated Antibody

C47040 100ul
EUR 397

Anti-DDX42 antibody

STJ190593 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DDX42

ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (HRP)

20-abx308343
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (FITC)

20-abx308344
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ATP-Dependent RNA Helicase DDX42 (DDX42) Antibody (Biotin)

20-abx308345
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DDX42 siRNA

20-abx913807
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDX42 siRNA

20-abx913808
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DDX42

YF-PA17593 50 ug
EUR 363
Description: Mouse polyclonal to DDX42

DDX42 Antibody, HRP conjugated

1-CSB-PA773053LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DDX42 Antibody, FITC conjugated

1-CSB-PA773053LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DDX42 Antibody, Biotin conjugated

1-CSB-PA773053LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX42. Recognizes DDX42 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DDX42 Blocking Peptide

33R-7187 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX42 antibody, catalog no. 70R-4789

DDX42 Blocking Peptide

DF9259-BP 1mg
EUR 195

DDX42 cloning plasmid

CSB-CL773053HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggctgaagtggaggatcaggcagctagagacatgaagaggcttgaagaaaaggacaaggaaagaaaaaacgtaaagggtattcgagatgacattgaagaggaagatgaccaagaagcttattttcgatacatggcagaaaacccaactgctggtgtggttcaggaggaagagg
  • Show more
Description: A cloning plasmid for the DDX42 gene.

Chicken ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit

abx517113-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit

abx517115-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human DDX42/ ATP-dependent RNA helicase DDX42 ELISA Kit

E0672Hu 1 Kit
EUR 605

Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E06A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E06A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E06A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E01A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E01A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E01A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E03A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E03A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E03A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ddx42/ ATP-dependent RNA helicase DDX42 ELISA Kit

E0386Mo 1 Kit
EUR 632

Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E02A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E02A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E02A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E07A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E07A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E07A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E09A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E09A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E09A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E08A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E08A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E08A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human DDX42(ATP-dependent RNA helicase DDX42) ELISA Kit

EH1652 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: Q86XP3
  • Alias: DDX42/ATP-dependent RNA helicase DDX42/Splicing factor 3B-associated 125 kDa protein/SF3b125/SF3b DEAD box protein/RNA helicase-related protein/RNAHP/DEAD box protein 42/RNA helicase-like prote
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Mouse ATP- dependent RNA helicase DDX42, Ddx42 ELISA KIT

ELI-26533m 96 Tests
EUR 865

Chicken ATP- dependent RNA helicase DDX42, DDX42 ELISA KIT

ELI-46923c 96 Tests
EUR 928

Human ATP- dependent RNA helicase DDX42, DDX42 ELISA KIT

ELI-31038h 96 Tests
EUR 824

Human ATP-Dependent RNA Helicase DDX42 (DDX42) ELISA Kit

abx250947-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E05A1834-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E05A1834-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ATP dependent RNA helicase DDX42(DDX42) ELISA kit

E05A1834-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX42(DDX42) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DDX42 ELISA Kit| chicken ATP-dependent RNA helicase DDX42 ELISA

EF012271 96 Tests
EUR 689

Mouse DDX42 shRNA Plasmid

20-abx977645
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DDX42 ELISA Kit

ELA-E14799h 96 Tests
EUR 824

DDX42 ELISA KIT|Human

EF005801 96 Tests
EUR 689

Human DDX42 shRNA Plasmid

20-abx957753
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Ddx42 ELISA Kit| Mouse ATP-dependent RNA helicase DDX42 ELISA K

EF014639 96 Tests
EUR 689

DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 (DDX42) polyclonal antibody

ABP-PAB-02241 100 ug Ask for price
    • Product line: Apoptosis
    • Brand:

DDX42 ORF Vector (Human) (pORF)

ORF003006 1.0 ug DNA
EUR 95

Ddx42 ORF Vector (Rat) (pORF)

ORF065886 1.0 ug DNA
EUR 506

Ddx42 ORF Vector (Mouse) (pORF)

ORF042809 1.0 ug DNA
EUR 506

DDX42 ELISA Kit (Human) (OKEH02374)

OKEH02374 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the Asp-Glu-Ala-Asp (DEAD) box protein family. Members of this protein family are putative RNA helicases, and are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. Two transcript variants encoding the same protein have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

DDX42 ELISA Kit (Mouse) (OKEH05469)

OKEH05469 96 Wells
EUR 779
Description: Description of target: ATP-dependent RNA helicase. Binds to partially double-stranded RNAs (dsRNAs) in order to unwind RNA secondary structures. Unwinding is promoted in the presence of single-strand binding proteins. Mediates also RNA duplex formation thereby displacing the single-strand RNA binding protein. ATP and ADP modulate its activity: ATP binding and hydrolysis by DDX42 triggers RNA strand separation, whereas the ADP-bound form of the protein triggers annealing of complementary RNA strands. Involved in the survival of cells by interacting with TP53BP2 and thereby counteracting the apoptosis-stimulating activity of TP53BP2. Relocalizes TP53BP2 to the cytoplasm.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.78 pg/mL

DDX42 ELISA Kit (Chicken) (OKEH08050)

OKEH08050 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

DDX42 sgRNA CRISPR Lentivector set (Human)

K0574001 3 x 1.0 ug
EUR 339

Ddx42 sgRNA CRISPR Lentivector set (Mouse)

K4569801 3 x 1.0 ug
EUR 339

Ddx42 sgRNA CRISPR Lentivector set (Rat)

K6341701 3 x 1.0 ug
EUR 339

DDX42 sgRNA CRISPR Lentivector (Human) (Target 1)

K0574002 1.0 ug DNA
EUR 154

DDX42 sgRNA CRISPR Lentivector (Human) (Target 2)

K0574003 1.0 ug DNA
EUR 154

DDX42 sgRNA CRISPR Lentivector (Human) (Target 3)

K0574004 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4569802 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4569803 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4569804 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6341702 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6341703 1.0 ug DNA
EUR 154

Ddx42 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6341704 1.0 ug DNA
EUR 154

DDX42 Protein Vector (Human) (pPB-C-His)

PV012021 500 ng
EUR 329

DDX42 Protein Vector (Human) (pPB-N-His)

PV012022 500 ng
EUR 329

DDX42 Protein Vector (Human) (pPM-C-HA)

PV012023 500 ng
EUR 329

DDX42 Protein Vector (Human) (pPM-C-His)

PV012024 500 ng
EUR 329

DDX42 Protein Vector (Mouse) (pPB-C-His)

PV171234 500 ng
EUR 1065

DDX42 Protein Vector (Mouse) (pPB-N-His)

PV171235 500 ng
EUR 1065

DDX42 Protein Vector (Mouse) (pPM-C-HA)

PV171236 500 ng
EUR 1065

DDX42 Protein Vector (Mouse) (pPM-C-His)

PV171237 500 ng
EUR 1065

DDX42 Protein Vector (Rat) (pPB-C-His)

PV263542 500 ng
EUR 1191

DDX42 Protein Vector (Rat) (pPB-N-His)

PV263543 500 ng
EUR 1191

DDX42 Protein Vector (Rat) (pPM-C-HA)

PV263544 500 ng
EUR 1191

DDX42 Protein Vector (Rat) (pPM-C-His)

PV263545 500 ng
EUR 1191

Ddx42 3'UTR Luciferase Stable Cell Line

TU203265 1.0 ml Ask for price

Ddx42 3'UTR GFP Stable Cell Line

TU154971 1.0 ml Ask for price

DDX42 3'UTR Luciferase Stable Cell Line

TU005719 1.0 ml
EUR 1394

Ddx42 3'UTR Luciferase Stable Cell Line

TU104971 1.0 ml Ask for price

DDX42 3'UTR GFP Stable Cell Line

TU055719 1.0 ml
EUR 1394

Ddx42 3'UTR GFP Stable Cell Line

TU253265 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DDX42 Rabbit Polyclonal Antibody