DDX50 Rabbit Polyclonal Antibody

DDX50 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

DDX50 Polyclonal Antibody

ABP58347-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DDX50 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of DDX50 from Human, Mouse. This DDX50 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DDX50 protein at amino acid sequence of 140-220

DDX50 Polyclonal Antibody

A58754 100 µg
EUR 570.55
Description: reagents widely cited

DDX50 Rabbit pAb

A8628-100ul 100 ul
EUR 308

DDX50 Rabbit pAb

A8628-200ul 200 ul
EUR 459

DDX50 Rabbit pAb

A8628-20ul 20 ul
EUR 183

DDX50 Rabbit pAb

A8628-50ul 50 ul
EUR 223

DDX50 antibody

70R-4785 50 ug
EUR 467
Description: Rabbit polyclonal DDX50 antibody

DDX50 Antibody

ABD3818 100 ug
EUR 438

DDX50 Antibody

47041-100ul 100ul
EUR 252

DDX50 antibody

10R-1400 100 ug
EUR 512
Description: Mouse monoclonal DDX50 antibody

DDX50 antibody

70R-1367 100 ug
EUR 377
Description: Rabbit polyclonal DDX50 antibody

DDX50 antibody

70R-16792 50 ul
EUR 435
Description: Rabbit polyclonal DDX50 antibody

DDX50 Antibody

DF3818 200ul
EUR 304
Description: DDX50 Antibody detects endogenous levels of total DDX50.

DDX50 Antibody

1-CSB-PA006631GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DDX50. Recognizes DDX50 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DDX50 Antibody

1-CSB-PA861080LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX50. Recognizes DDX50 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

DDX50 Polyclonal Antibody, Biotin Conjugated

A58755 100 µg
EUR 570.55
Description: Ask the seller for details

DDX50 Polyclonal Antibody, FITC Conjugated

A58756 100 µg
EUR 570.55
Description: The best epigenetics products

DDX50 Polyclonal Antibody, HRP Conjugated

A58757 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rabbit ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E04A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E04A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E04A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

DDX50 Conjugated Antibody

C47041 100ul
EUR 397

anti- DDX50 antibody

FNab02313 100µg
EUR 505.25
  • Immunogen: DEAD(Asp-Glu-Ala-Asp) box polypeptide 50
  • Uniprot ID: Q9BQ39
  • Gene ID: 79009
  • Research Area: Metabolism
Description: Antibody raised against DDX50

Anti-DDX50 antibody

PAab02313 100 ug
EUR 355

Anti-DDX50 antibody

STJ113576 100 µl
EUR 277
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box enzyme that may be involved in ribosomal RNA synthesis or processing. This gene and DDX21, also called RH-II/GuA, have similar genomic structures and are in tandem orientation on chromosome 10, suggesting that the two genes arose by gene duplication in evolution. This gene has pseudogenes on chromosomes 2, 3 and 4. Alternative splicing of this gene generates multiple transcript variants, but the full length nature of all the other variants but one has not been defined.

Anti-DDX50 antibody

STJ190594 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DDX50

DDX50 siRNA

20-abx913818
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DDX50 siRNA

20-abx913819
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DDX50

YF-PA20710 50 ul
EUR 363
Description: Mouse polyclonal to DDX50

anti-DDX50

YF-PA20711 100 ug
EUR 403
Description: Rabbit polyclonal to DDX50

DDX50 Antibody, HRP conjugated

1-CSB-PA861080LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX50. Recognizes DDX50 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DDX50 Antibody, FITC conjugated

1-CSB-PA861080LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX50. Recognizes DDX50 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DDX50 Antibody, Biotin conjugated

1-CSB-PA861080LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DDX50. Recognizes DDX50 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DDX50 Blocking Peptide

33R-2388 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX50 antibody, catalog no. 70R-1367

DDX50 Blocking Peptide

33R-7109 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DDX50 antibody, catalog no. 70R-4785

DDX50 cloning plasmid

CSB-CL861080HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2214
  • Sequence: atgcctgggaaactcctctggggggacattatggagctggaagcacccttggaggagtccgagagccagaagaaggagaggcaaaagagtgacagaaggaagtcaaggcaccattatgactcggatgagaaatcagaaacaagagaaaatggtgttacagatgacctggatgctc
  • Show more
Description: A cloning plasmid for the DDX50 gene.

DDX50 Blocking Peptide

DF3818-BP 1mg
EUR 195

Goat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E06A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E06A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E06A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E01A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E01A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E01A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E03A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E03A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E03A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E02A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E02A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E02A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E07A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E07A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E07A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E09A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E09A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E09A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E08A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E08A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E08A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ATP- dependent RNA helicase DDX50, DDX50 ELISA KIT

ELI-26535h 96 Tests
EUR 824

Mouse ATP- dependent RNA helicase DDX50, Ddx50 ELISA KIT

ELI-31839m 96 Tests
EUR 865

Human ATP-Dependent RNA Helicase DDX50 (DDX50) ELISA Kit

abx386841-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Guinea pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E05A1835-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E05A1835-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ATP dependent RNA helicase DDX50(DDX50) ELISA kit

E05A1835-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ATP dependent RNA helicase DDX50(DDX50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DDX50 shRNA Plasmid

20-abx979290
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDX50 ELISA KIT|Human

EF009062 96 Tests
EUR 689

Human DDX50 shRNA Plasmid

20-abx962252
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DDX50 Recombinant Protein (Human)

RP009034 100 ug Ask for price

pENTR223-DDX50-A321 vector

PVT11850 2 ug
EUR 304

DDX50 Recombinant Protein (Rat)

RP197669 100 ug Ask for price

DDX50 Recombinant Protein (Mouse)

RP128441 100 ug Ask for price

DDX50 ORF Vector (Human) (pORF)

ORF003012 1.0 ug DNA
EUR 95

Ddx50 ORF Vector (Rat) (pORF)

ORF065891 1.0 ug DNA
EUR 506

Ddx50 ORF Vector (Mouse) (pORF)

ORF042815 1.0 ug DNA
EUR 506

DDX50 sgRNA CRISPR Lentivector set (Human)

K0574501 3 x 1.0 ug
EUR 339

Ddx50 sgRNA CRISPR Lentivector set (Mouse)

K3562201 3 x 1.0 ug
EUR 339

Ddx50 sgRNA CRISPR Lentivector set (Rat)

K7404101 3 x 1.0 ug
EUR 339

DDX50 sgRNA CRISPR Lentivector (Human) (Target 1)

K0574502 1.0 ug DNA
EUR 154

DDX50 sgRNA CRISPR Lentivector (Human) (Target 2)

K0574503 1.0 ug DNA
EUR 154

DDX50 sgRNA CRISPR Lentivector (Human) (Target 3)

K0574504 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3562202 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3562203 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3562204 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7404102 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7404103 1.0 ug DNA
EUR 154

Ddx50 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7404104 1.0 ug DNA
EUR 154

DDX50 Protein Vector (Human) (pPB-C-His)

PV012045 500 ng
EUR 329

DDX50 Protein Vector (Human) (pPB-N-His)

PV012046 500 ng
EUR 329

DDX50 Protein Vector (Human) (pPM-C-HA)

PV012047 500 ng
EUR 329

DDX50 Protein Vector (Human) (pPM-C-His)

PV012048 500 ng
EUR 329

DDX50 Protein Vector (Mouse) (pPB-C-His)

PV171258 500 ng
EUR 1065

DDX50 Protein Vector (Mouse) (pPB-N-His)

PV171259 500 ng
EUR 1065

DDX50 Protein Vector (Mouse) (pPM-C-HA)

PV171260 500 ng
EUR 1065

DDX50 Protein Vector (Mouse) (pPM-C-His)

PV171261 500 ng
EUR 1065

DDX50 Protein Vector (Rat) (pPB-C-His)

PV263562 500 ng
EUR 1166

DDX50 Protein Vector (Rat) (pPB-N-His)

PV263563 500 ng
EUR 1166

DDX50 Protein Vector (Rat) (pPM-C-HA)

PV263564 500 ng
EUR 1166

DDX50 Protein Vector (Rat) (pPM-C-His)

PV263565 500 ng
EUR 1166

Ddx50 3'UTR Luciferase Stable Cell Line

TU203270 1.0 ml Ask for price

Ddx50 3'UTR GFP Stable Cell Line

TU154977 1.0 ml Ask for price

DDX50 3'UTR Luciferase Stable Cell Line

TU005724 1.0 ml
EUR 1394

Ddx50 3'UTR Luciferase Stable Cell Line

TU104977 1.0 ml Ask for price

DDX50 3'UTR GFP Stable Cell Line

TU055724 1.0 ml
EUR 1394

Ddx50 3'UTR GFP Stable Cell Line

TU253270 1.0 ml Ask for price

DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 50 (DDX50) Antibody

20-abx124775
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 50 (DDX50) Antibody

20-abx111986
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 50 (DDX50) Antibody

abx122708-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 50 (DDX50) Antibody

20-abx302837
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DEAD (Asp-Glu-Ala-Asp) Box Polypeptide 50 (DDX50) Antibody

abx232313-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

DDX50 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV635359 1.0 ug DNA
EUR 1355

DDX50 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV635363 1.0 ug DNA
EUR 1355

DDX50 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV635364 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

DDX50 Rabbit Polyclonal Antibody