DLX1 Rabbit Polyclonal Antibody
DLX1 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 DLX1 Polyclonal Antibody |
|
ABP58387-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DLX1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DLX1 from Human, Mouse, Rat. This DLX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DLX1 protein |
DLX1 Polyclonal Antibody |
|
ABP58387-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DLX1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of DLX1 from Human, Mouse, Rat. This DLX1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DLX1 protein |
DLX1 Polyclonal Antibody |
|
A68519 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: fast delivery possible |
DLX1 Polyclonal Antibody |
|
30030-100ul |
SAB |
100ul |
EUR 252 |
DLX1 Polyclonal Antibody |
|
30030-50ul |
SAB |
50ul |
EUR 187 |
 DLX1 Rabbit pAb |
|
A17381-100ul |
Abclonal |
100 ul |
EUR 384 |
DLX1 Rabbit pAb |
|
A17381-200ul |
Abclonal |
200 ul |
EUR 554 |
DLX1 Rabbit pAb |
|
A17381-20ul |
Abclonal |
20 ul |
EUR 183 |
DLX1 Rabbit pAb |
|
A17381-50ul |
Abclonal |
50 ul |
EUR 265 |
 DLX1 Polyclonal Conjugated Antibody |
|
C30030 |
SAB |
100ul |
EUR 397 |
 DLX1 antibody |
|
70R-16856 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal DLX1 antibody |
 DLX1 Antibody |
|
1-CSB-PA006952GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against DLX1. Recognizes DLX1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
DLX1 Antibody |
|
1-CSB-PA006952LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DLX1. Recognizes DLX1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
 DLX1 Polyclonal Antibody, HRP Conjugated |
|
A68520 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: reagents widely cited |
 DLX1 Polyclonal Antibody, FITC Conjugated |
|
A68521 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: Ask the seller for details |
 DLX1 Polyclonal Antibody, Biotin Conjugated |
|
A68522 |
EpiGentek |
100 ?g |
EUR 628.55 |
|
Description: The best epigenetics products |
 Polyclonal DLX1 antibody - C-terminal region |
|
APR11759G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DLX1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
 Polyclonal DLX1 antibody - N-terminal region |
|
APR11760G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DLX1 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 anti- DLX1 antibody |
|
FNab02417 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: distal-less homeobox 1
- Uniprot ID: P56177
- Gene ID: 1745
- Research Area: Neuroscience, Metabolism, Developmental biology
|
|
Description: Antibody raised against DLX1 |
 Anti-DLX1 antibody |
|
STJ190876 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DLX1 |
 DLX1 siRNA |
|
20-abx914246 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DLX1 siRNA |
|
20-abx914247 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-Dlx1 |
|
YF-PA11373 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Dlx1 |
anti-Dlx1 |
|
YF-PA11374 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Dlx1 |
 DLX1 Antibody, HRP conjugated |
|
1-CSB-PA006952LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DLX1. Recognizes DLX1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 DLX1 Antibody, FITC conjugated |
|
1-CSB-PA006952LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DLX1. Recognizes DLX1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 DLX1 Antibody, Biotin conjugated |
|
1-CSB-PA006952LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against DLX1. Recognizes DLX1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 DLX1 cloning plasmid |
|
CSB-CL006952HU-10ug |
Cusabio |
10ug |
EUR 308 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 708
- Sequence: atggagtttgggccgcccaaccagcaaatgtctccttctcccatgtcccacgggcactactccatgcactgtttacactcggcgggccattcgcagcccgacggcgcctacagctcagcctcgtccttctcccgaccgctgggctacccctacgtcaactcggtcagcagccacgc
- Show more
|
|
Description: A cloning plasmid for the DLX1 gene. |
) Anti-Dlx1 (3C7) |
|
YF-MA12689 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (3F9) |
|
YF-MA12690 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (1D11) |
|
YF-MA12691 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (1B2) |
|
YF-MA12692 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (4H7) |
|
YF-MA12693 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (4B7) |
|
YF-MA12694 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
) Anti-Dlx1 (2H3) |
|
YF-MA10244 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Dlx1 |
 Human DLX1 shRNA Plasmid |
|
20-abx951212 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse DLX1 shRNA Plasmid |
|
20-abx970012 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DLX1 Recombinant Protein (Human) |
|
RP009439 |
ABM |
100 ug |
Ask for price |
) DLX1 Recombinant Protein (Rat) |
|
RP198182 |
ABM |
100 ug |
Ask for price |
) DLX1 Recombinant Protein (Mouse) |
|
RP129275 |
ABM |
100 ug |
Ask for price |
 Antibody) Distal-Less Homeobox 1 (DLX1) Antibody |
|
20-abx112107 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Distal-Less Homeobox 1 (DLX1) Antibody |
|
20-abx333715 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Distal-Less Homeobox 1 (DLX1) Antibody |
|
abx232417-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
 (M01), Clone: 2H3) Monoclonal DLX1 Antibody (monoclonal) (M01), Clone: 2H3 |
|
APR11757G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human DLX1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2H3. This antibody is applicable in WB and IF, IP, E |
 (M02), Clone: 3C7) Monoclonal DLX1 Antibody (monoclonal) (M02), Clone: 3C7 |
|
APR11758G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human DLX1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 3C7. This antibody is applicable in WB, E |
 Antibody (HRP)) Distal-Less Homeobox 1 (DLX1) Antibody (HRP) |
|
20-abx336003 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Distal-Less Homeobox 1 (DLX1) Antibody (FITC) |
|
20-abx336004 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Distal-Less Homeobox 1 (DLX1) Antibody (Biotin) |
|
20-abx336005 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) DLX1 ORF Vector (Human) (pORF) |
|
ORF003147 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Dlx1 ORF Vector (Rat) (pORF) |
|
ORF066062 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Dlx1 ORF Vector (Mouse) (pORF) |
|
ORF043093 |
ABM |
1.0 ug DNA |
EUR 506 |
) DLX1 sgRNA CRISPR Lentivector set (Human) |
|
K0608201 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dlx1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4709701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dlx1 sgRNA CRISPR Lentivector set (Rat) |
|
K7222901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) DLX1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0608202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DLX1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0608203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DLX1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0608204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dlx1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4709702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dlx1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4709703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dlx1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4709704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dlx1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7222902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dlx1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7222903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dlx1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7222904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DLX1 Protein Vector (Human) (pPB-C-His) |
|
PV012585 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) DLX1 Protein Vector (Human) (pPB-N-His) |
|
PV012586 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) DLX1 Protein Vector (Human) (pPM-C-HA) |
|
PV012587 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) DLX1 Protein Vector (Human) (pPM-C-His) |
|
PV012588 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) DLX1 Protein Vector (Mouse) (pPB-C-His) |
|
PV172370 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DLX1 Protein Vector (Mouse) (pPB-N-His) |
|
PV172371 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DLX1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV172372 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DLX1 Protein Vector (Mouse) (pPM-C-His) |
|
PV172373 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DLX1 Protein Vector (Rat) (pPB-C-His) |
|
PV264246 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DLX1 Protein Vector (Rat) (pPB-N-His) |
|
PV264247 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DLX1 Protein Vector (Rat) (pPM-C-HA) |
|
PV264248 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DLX1 Protein Vector (Rat) (pPM-C-His) |
|
PV264249 |
ABM |
500 ng |
EUR 603 |
 Dlx1 3'UTR Luciferase Stable Cell Line |
|
TU203458 |
ABM |
1.0 ml |
Ask for price |
 Dlx1 3'UTR GFP Stable Cell Line |
|
TU155195 |
ABM |
1.0 ml |
Ask for price |
 DLX1 3'UTR Luciferase Stable Cell Line |
|
TU006074 |
ABM |
1.0 ml |
EUR 1521 |
Dlx1 3'UTR Luciferase Stable Cell Line |
|
TU105195 |
ABM |
1.0 ml |
Ask for price |
 DLX1 3'UTR GFP Stable Cell Line |
|
TU056074 |
ABM |
1.0 ml |
EUR 1521 |
Dlx1 3'UTR GFP Stable Cell Line |
|
TU253458 |
ABM |
1.0 ml |
Ask for price |
 Mouse Homeobox protein DLX- 1, Dlx1 ELISA KIT |
|
ELI-26063m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Homeobox protein DLX- 1, DLX1 ELISA KIT |
|
ELI-47097h |
Lifescience Market |
96 Tests |
EUR 824 |
 ELISA Kit) Human Distal-Less Homeobox 1 (DLX1) ELISA Kit |
|
abx386906-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) DLX1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV658981 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) DLX1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV658985 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) DLX1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV658986 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
|
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
DLX1 Rabbit Polyclonal Antibody
