DNA2 Rabbit Polyclonal Antibody

DNA2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

DNA2 Polyclonal Antibody
ABP58396-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DNA2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DNA2 from Human, Mouse. This DNA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNA2 protein
DNA2 Polyclonal Antibody
ABP58396-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DNA2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DNA2 from Human, Mouse. This DNA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNA2 protein
DNA2 Polyclonal Antibody
A62414 100 µg
EUR 570.55
Description: kits suitable for this type of research
DNA2 Polyclonal Antibody
ES9598-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DNA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DNA2 Polyclonal Antibody
ES9598-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DNA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DNA2 antibody
70R-16865 50 ul
EUR 435
Description: Rabbit polyclonal DNA2 antibody
DNA2 Antibody
1-CSB-PA006982GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
DNA2 Antibody
1-CSB-PA006982LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
DNA2 antibody
PAab10066 100 ug
EUR 386
DNA2 Polyclonal Antibody, HRP Conjugated
A62415 100 µg
EUR 570.55
Description: fast delivery possible
DNA2 Polyclonal Antibody, FITC Conjugated
A62416 100 µg
EUR 570.55
Description: reagents widely cited
DNA2 Polyclonal Antibody, Biotin Conjugated
A62417 100 µg
EUR 570.55
Description: Ask the seller for details
anti- DNA2 antibody
FNab10066 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:20-1:200
  • Immunogen: DNA replication helicase 2 homolog
  • Uniprot ID: P51530
  • Gene ID: 1763
  • Research Area: Metabolism
Description: Antibody raised against DNA2
anti- DNA2 antibody
FNab02433 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: DNA replication helicase 2 homolog
  • Uniprot ID: P51530
  • Gene ID: 1763
  • Research Area: Metabolism
Description: Antibody raised against DNA2
Anti-DNA2 antibody
PAab02433 100 ug
EUR 386
Anti-DNA2 antibody
STJ190756 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DNA2
DNA2 siRNA
20-abx914302
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNA2 siRNA
20-abx914303
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody
20-abx112118
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody
20-abx124311
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody
abx122153-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody
20-abx301176
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody
abx232433-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
DNA2 Antibody, HRP conjugated
1-CSB-PA006982LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DNA2 Antibody, FITC conjugated
1-CSB-PA006982LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DNA2 Antibody, Biotin conjugated
1-CSB-PA006982LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Chicken DNA2- like helicase, DNA2 ELISA KIT
ELI-26010c 96 Tests
EUR 928
Mouse DNA2- like helicase, Dna2 ELISA KIT
ELI-26212m 96 Tests
EUR 865
Human DNA2-Like Helicase (DNA2) ELISA Kit
abx386919-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human DNA2- like helicase, DNA2 ELISA KIT
ELI-31725h 96 Tests
EUR 824
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (HRP)
20-abx303629
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (FITC)
20-abx303630
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (Biotin)
20-abx303631
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Mouse DNA2-like helicase (DNA2)
KTE71231-48T 48T
EUR 332
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse DNA2-like helicase (DNA2)
KTE71231-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Mouse DNA2-like helicase (DNA2)
KTE71231-96T 96T
EUR 539
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human DNA2-like helicase (DNA2)
KTE62003-48T 48T
EUR 332
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human DNA2-like helicase (DNA2)
KTE62003-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human DNA2-like helicase (DNA2)
KTE62003-96T 96T
EUR 539
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken DNA2-like helicase (DNA2)
KTE30132-48T 48T
EUR 354
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken DNA2-like helicase (DNA2)
KTE30132-5platesof96wells 5 plates of 96 wells
EUR 2252
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Chicken DNA2-like helicase (DNA2)
KTE30132-96T 96T
EUR 572
  • DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
DNA2 cloning plasmid
CSB-CL006982HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2064
  • Sequence: ATGGAGCAGCTGAACGAACTGGAGCTGCTGATGGAGAAGAGTTTTTGGGAGGAGGCGGAGCTGCCGGCGGAGCTATTTCAGAAGAAAGTGGTAGCTTCCTTTCCAAGAACAGTTCTGAGCACAGGAATGGATAACCGGTACCTGGTGTTGGCAGTCAATACTGTACAGAACAAAG
  • Show more
Description: A cloning plasmid for the DNA2 gene.
DNA2 inhibitor C5
HY-128729 10mM/1mL
EUR 199
DNA2 ELISA KIT|Human
EF009145 96 Tests
EUR 689
Mouse DNA2 shRNA Plasmid
20-abx983492
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DNA2 Rabbit Polyclonal Antibody

Site Title, Some rights reserved.

Terms of Use - Privacy Policy

WordPress Di Business Theme