DNA2 Rabbit Polyclonal Antibody
DNA2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
DNA2 Polyclonal Antibody |
ABP58396-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DNA2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DNA2 from Human, Mouse. This DNA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNA2 protein |
DNA2 Polyclonal Antibody |
ABP58396-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DNA2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DNA2 from Human, Mouse. This DNA2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DNA2 protein |
DNA2 Polyclonal Antibody |
A62414 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
DNA2 Polyclonal Antibody |
ES9598-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DNA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DNA2 Polyclonal Antibody |
ES9598-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DNA2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DNA2 antibody |
70R-16865 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DNA2 antibody |
DNA2 Antibody |
1-CSB-PA006982GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DNA2 Antibody |
1-CSB-PA006982LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
DNA2 Polyclonal Antibody, HRP Conjugated |
A62415 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
DNA2 Polyclonal Antibody, FITC Conjugated |
A62416 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
DNA2 Polyclonal Antibody, Biotin Conjugated |
A62417 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
anti- DNA2 antibody |
FNab10066 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: IHC: 1:20-1:200
- Immunogen: DNA replication helicase 2 homolog
- Uniprot ID: P51530
- Gene ID: 1763
- Research Area: Metabolism
|
Description: Antibody raised against DNA2 |
anti- DNA2 antibody |
FNab02433 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- IHC: 1:50-1:500
- IF: 1:10-1:100
- Immunogen: DNA replication helicase 2 homolog
- Uniprot ID: P51530
- Gene ID: 1763
- Research Area: Metabolism
|
Description: Antibody raised against DNA2 |
Anti-DNA2 antibody |
STJ190756 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DNA2 |
DNA2 siRNA |
20-abx914302 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA2 siRNA |
20-abx914303 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody |
20-abx112118 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody |
20-abx124311 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody |
abx122153-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody |
20-abx301176 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody |
abx232433-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
DNA2 Antibody, HRP conjugated |
1-CSB-PA006982LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DNA2 Antibody, FITC conjugated |
1-CSB-PA006982LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DNA2 Antibody, Biotin conjugated |
1-CSB-PA006982LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DNA2. Recognizes DNA2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Chicken DNA2- like helicase, DNA2 ELISA KIT |
ELI-26010c |
Lifescience Market |
96 Tests |
EUR 928 |
Human DNA2-Like Helicase (DNA2) ELISA Kit |
abx386919-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (HRP) |
20-abx303629 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (FITC) |
20-abx303630 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DNA Replication ATP-Dependent Helicase/Nuclease DNA2 (DNA2) Antibody (Biotin) |
20-abx303631 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Mouse DNA2-like helicase (DNA2) |
KTE71231-48T |
Abbkine |
48T |
EUR 332 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse DNA2-like helicase (DNA2) |
KTE71231-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse DNA2-like helicase (DNA2) |
KTE71231-96T |
Abbkine |
96T |
EUR 539 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human DNA2-like helicase (DNA2) |
KTE62003-48T |
Abbkine |
48T |
EUR 332 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human DNA2-like helicase (DNA2) |
KTE62003-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human DNA2-like helicase (DNA2) |
KTE62003-96T |
Abbkine |
96T |
EUR 539 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken DNA2-like helicase (DNA2) |
KTE30132-48T |
Abbkine |
48T |
EUR 354 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken DNA2-like helicase (DNA2) |
KTE30132-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken DNA2-like helicase (DNA2) |
KTE30132-96T |
Abbkine |
96T |
EUR 572 |
- DNA2 interacted with mitochondrial DNA polymerase-gamma and significantly stimulated its polymerase activity. DNA2 and flap endonuclease-1 (FEN1) synergistically processed intermediate 5-prime flap structures occurring in DNA replication and long-pat
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken DNA2-like helicase (DNA2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DNA2 cloning plasmid |
CSB-CL006982HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2064
- Sequence: ATGGAGCAGCTGAACGAACTGGAGCTGCTGATGGAGAAGAGTTTTTGGGAGGAGGCGGAGCTGCCGGCGGAGCTATTTCAGAAGAAAGTGGTAGCTTCCTTTCCAAGAACAGTTCTGAGCACAGGAATGGATAACCGGTACCTGGTGTTGGCAGTCAATACTGTACAGAACAAAG
- Show more
|
Description: A cloning plasmid for the DNA2 gene. |
Mouse DNA2 shRNA Plasmid |
20-abx983492 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DNA2 Rabbit Polyclonal Antibody