EDC4 Rabbit Polyclonal Antibody

EDC4 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

EDC4 Polyclonal Antibody
ABP58452-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EDC4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDC4 from Human, Mouse, Rat. This EDC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDC4 protein
EDC4 Polyclonal Antibody
ABP58452-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EDC4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of EDC4 from Human, Mouse, Rat. This EDC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDC4 protein
EDC4 Polyclonal Antibody
A68951 100 ?g
EUR 628.55
Description: reagents widely cited
EDC4 Polyclonal Antibody
ES9647-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
EDC4 Polyclonal Antibody
ES9647-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
EDC4 Rabbit pAb
A15418-100ul 100 ul
EUR 308
EDC4 Rabbit pAb
A15418-200ul 200 ul
EUR 459
EDC4 Rabbit pAb
A15418-20ul 20 ul
EUR 183
EDC4 Rabbit pAb
A15418-50ul 50 ul
EUR 223
EDC4 antibody
70R-16993 50 ul
EUR 435
Description: Rabbit polyclonal EDC4 antibody
EDC4 Antibody
45970-100ul 100ul
EUR 252
EDC4 Antibody
45970-50ul 50ul
EUR 187
EDC4 Antibody
1-CSB-PA744034LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
EDC4 Antibody
DF9501 200ul
EUR 304
Description: EDC4 Antibody detects endogenous levels of total EDC4.
EDC4 antibody
70R-4230 50 ug
EUR 467
Description: Rabbit polyclonal EDC4 antibody raised against the N terminal of EDC4
EDC4 Antibody
1-CSB-PA007394GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
EDC4 Antibody
ABD9501 100 ug
EUR 438
EDC4 Polyclonal Antibody, HRP Conjugated
A68952 100 ?g
EUR 628.55
Description: Ask the seller for details
EDC4 Polyclonal Antibody, FITC Conjugated
A68953 100 ?g
EUR 628.55
Description: The best epigenetics products
EDC4 Polyclonal Antibody, Biotin Conjugated
A68954 100 ?g
EUR 628.55
Description: kits suitable for this type of research
Edc4/ Rat Edc4 ELISA Kit
ELI-31564r 96 Tests
EUR 886
EDC4 Conjugated Antibody
C45970 100ul
EUR 397
anti- EDC4 antibody
FNab02631 100µg
EUR 505.25
  • Immunogen: enhancer of mRNA decapping 4
  • Uniprot ID: Q6P2E9
  • Gene ID: 23644
  • Research Area: Signal Transduction
Description: Antibody raised against EDC4
Anti-EDC4 antibody
PAab02631 100 ug
EUR 355
Anti-EDC4 antibody
STJ117613 100 µl
EUR 277
Anti-EDC4 antibody
STJ190805 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDC4
EDC4 siRNA
20-abx901635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EDC4 siRNA
20-abx914945
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EDC4 siRNA
20-abx914946
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-EDC4
YF-PA18021 50 ul
EUR 363
Description: Mouse polyclonal to EDC4
EDC4 Antibody, HRP conjugated
1-CSB-PA744034LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
EDC4 Antibody, FITC conjugated
1-CSB-PA744034LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
EDC4 Antibody, Biotin conjugated
1-CSB-PA744034LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EDC4 Blocking Peptide
33R-5303 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDC4 antibody, catalog no. 70R-4230
EDC4 Blocking Peptide
DF9501-BP 1mg
EUR 195
EDC4 cloning plasmid
CSB-CL744034HU-10ug 10ug
EUR 1650
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4206
  • Sequence: atggcctcctgcgcgagcatcgacatcgaggacgccacgcagcacctgcgggacatcctcaagctggaccggcccgcgggcggccccagtgcagagagcccacggccatccagtgcctacaatggggacctcaatggacttctggtcccagacccgctctgctcaggtgatagta
  • Show more
Description: A cloning plasmid for the EDC4 gene.
Anti-EDC4 (2E2)
YF-MA17959 100 ug
EUR 363
Description: Mouse monoclonal to EDC4
EDC4 ELISA KIT|Human
EF009289 96 Tests
EUR 689
Rat EDC4 shRNA Plasmid
20-abx990186
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human EDC4 shRNA Plasmid
20-abx958418
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse EDC4 shRNA Plasmid
20-abx982149
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody
20-abx215065
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Enhancer of mRNA-Decapping 4 (EDC4) Antibody
20-abx112297
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody
20-abx334163
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Enhancer of mRNA-Decapping 4 (EDC4) Antibody
abx232631-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Edc4 ORF Vector (Rat) (pORF)
ORF066349 1.0 ug DNA
EUR 2080
EDC4 ORF Vector (Human) (pORF)
ORF003386 1.0 ug DNA
EUR 95
Edc4 ORF Vector (Mouse) (pORF)
ORF043617 1.0 ug DNA
EUR 1572
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (HRP)
20-abx335571
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (FITC)
20-abx335572
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (Biotin)
20-abx335573
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EDC4 sgRNA CRISPR Lentivector set (Human)
K0653301 3 x 1.0 ug
EUR 339
Edc4 sgRNA CRISPR Lentivector set (Rat)
K7490301 3 x 1.0 ug
EUR 339
Edc4 sgRNA CRISPR Lentivector set (Mouse)
K3355401 3 x 1.0 ug
EUR 339
EDC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0653302 1.0 ug DNA
EUR 154
EDC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0653303 1.0 ug DNA
EUR 154
EDC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0653304 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7490302 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7490303 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7490304 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3355402 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3355403 1.0 ug DNA
EUR 154
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3355404 1.0 ug DNA
EUR 154
EDC4 Protein Vector (Mouse) (pPB-C-His)
PV174466 500 ng
EUR 2370
EDC4 Protein Vector (Mouse) (pPB-N-His)
PV174467 500 ng
EUR 2370
EDC4 Protein Vector (Mouse) (pPM-C-HA)
PV174468 500 ng
EUR 2370
EDC4 Protein Vector (Mouse) (pPM-C-His)
PV174469 500 ng
EUR 2370
EDC4 Protein Vector (Rat) (pPB-C-His)
PV265394 500 ng
EUR 2396
EDC4 Protein Vector (Rat) (pPB-N-His)
PV265395 500 ng
EUR 2396
EDC4 Protein Vector (Rat) (pPM-C-HA)
PV265396 500 ng
EUR 2396
EDC4 Protein Vector (Rat) (pPM-C-His)
PV265397 500 ng
EUR 2396
EDC4 Protein Vector (Human) (pPB-C-His)
PV013541 500 ng
EUR 329
EDC4 Protein Vector (Human) (pPB-N-His)
PV013542 500 ng
EUR 329
EDC4 Protein Vector (Human) (pPM-C-HA)
PV013543 500 ng
EUR 329
EDC4 Protein Vector (Human) (pPM-C-His)
PV013544 500 ng
EUR 329
Edc4 3'UTR GFP Stable Cell Line
TU155595 1.0 ml Ask for price
Edc4 3'UTR Luciferase Stable Cell Line
TU105595 1.0 ml Ask for price
Edc4 3'UTR Luciferase Stable Cell Line
TU203774 1.0 ml Ask for price
Edc4 3'UTR GFP Stable Cell Line
TU253774 1.0 ml Ask for price
EDC4 3'UTR GFP Stable Cell Line
TU056554 1.0 ml
EUR 1394
EDC4 3'UTR Luciferase Stable Cell Line
TU006554 1.0 ml
EUR 1394
EDC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665557 1.0 ug DNA
EUR 2241
EDC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665561 1.0 ug DNA
EUR 2241
EDC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665562 1.0 ug DNA
EUR 2241
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

EDC4 Rabbit Polyclonal Antibody