EDC4 Rabbit Polyclonal Antibody
EDC4 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
EDC4 Polyclonal Antibody |
ABP58452-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EDC4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of EDC4 from Human, Mouse, Rat. This EDC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDC4 protein |
EDC4 Polyclonal Antibody |
ABP58452-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EDC4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of EDC4 from Human, Mouse, Rat. This EDC4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EDC4 protein |
EDC4 Polyclonal Antibody |
A68951 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
EDC4 Polyclonal Antibody |
ES9647-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EDC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EDC4 Polyclonal Antibody |
ES9647-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EDC4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EDC4 Rabbit pAb |
A15418-100ul |
Abclonal |
100 ul |
EUR 308 |
EDC4 Rabbit pAb |
A15418-200ul |
Abclonal |
200 ul |
EUR 459 |
EDC4 Rabbit pAb |
A15418-20ul |
Abclonal |
20 ul |
EUR 183 |
EDC4 Rabbit pAb |
A15418-50ul |
Abclonal |
50 ul |
EUR 223 |
EDC4 antibody |
70R-16993 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EDC4 antibody |
EDC4 Antibody |
45970-100ul |
SAB |
100ul |
EUR 252 |
EDC4 Antibody |
45970-50ul |
SAB |
50ul |
EUR 187 |
EDC4 Antibody |
1-CSB-PA744034LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
EDC4 Antibody |
DF9501 |
Affbiotech |
200ul |
EUR 304 |
Description: EDC4 Antibody detects endogenous levels of total EDC4. |
EDC4 antibody |
70R-4230 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EDC4 antibody raised against the N terminal of EDC4 |
EDC4 Antibody |
1-CSB-PA007394GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
EDC4 Polyclonal Antibody, HRP Conjugated |
A68952 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
EDC4 Polyclonal Antibody, FITC Conjugated |
A68953 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
EDC4 Polyclonal Antibody, Biotin Conjugated |
A68954 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
EDC4 Conjugated Antibody |
C45970 |
SAB |
100ul |
EUR 397 |
anti- EDC4 antibody |
FNab02631 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: enhancer of mRNA decapping 4
- Uniprot ID: Q6P2E9
- Gene ID: 23644
- Research Area: Signal Transduction
|
Description: Antibody raised against EDC4 |
Anti-EDC4 antibody |
STJ190805 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EDC4 |
EDC4 siRNA |
20-abx901635 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDC4 siRNA |
20-abx914945 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDC4 siRNA |
20-abx914946 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-EDC4 |
YF-PA18021 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to EDC4 |
EDC4 Antibody, HRP conjugated |
1-CSB-PA744034LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EDC4 Antibody, FITC conjugated |
1-CSB-PA744034LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EDC4 Antibody, Biotin conjugated |
1-CSB-PA744034LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EDC4. Recognizes EDC4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EDC4 Blocking Peptide |
33R-5303 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EDC4 antibody, catalog no. 70R-4230 |
EDC4 Blocking Peptide |
DF9501-BP |
Affbiotech |
1mg |
EUR 195 |
EDC4 cloning plasmid |
CSB-CL744034HU-10ug |
Cusabio |
10ug |
EUR 1650 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4206
- Sequence: atggcctcctgcgcgagcatcgacatcgaggacgccacgcagcacctgcgggacatcctcaagctggaccggcccgcgggcggccccagtgcagagagcccacggccatccagtgcctacaatggggacctcaatggacttctggtcccagacccgctctgctcaggtgatagta
- Show more
|
Description: A cloning plasmid for the EDC4 gene. |
Anti-EDC4 (2E2) |
YF-MA17959 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EDC4 |
Rat EDC4 shRNA Plasmid |
20-abx990186 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EDC4 shRNA Plasmid |
20-abx958418 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EDC4 shRNA Plasmid |
20-abx982149 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody |
20-abx215065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Enhancer of mRNA-Decapping 4 (EDC4) Antibody |
20-abx112297 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody |
20-abx334163 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Enhancer of mRNA-Decapping 4 (EDC4) Antibody |
abx232631-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Edc4 ORF Vector (Rat) (pORF) |
ORF066349 |
ABM |
1.0 ug DNA |
EUR 2080 |
EDC4 ORF Vector (Human) (pORF) |
ORF003386 |
ABM |
1.0 ug DNA |
EUR 95 |
Edc4 ORF Vector (Mouse) (pORF) |
ORF043617 |
ABM |
1.0 ug DNA |
EUR 1572 |
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (HRP) |
20-abx335571 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (FITC) |
20-abx335572 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Enhancer Of mRNA-Decapping 4 (EDC4) Antibody (Biotin) |
20-abx335573 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
EDC4 sgRNA CRISPR Lentivector set (Human) |
K0653301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Edc4 sgRNA CRISPR Lentivector set (Rat) |
K7490301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Edc4 sgRNA CRISPR Lentivector set (Mouse) |
K3355401 |
ABM |
3 x 1.0 ug |
EUR 339 |
EDC4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0653302 |
ABM |
1.0 ug DNA |
EUR 154 |
EDC4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0653303 |
ABM |
1.0 ug DNA |
EUR 154 |
EDC4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0653304 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7490302 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7490303 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7490304 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3355402 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3355403 |
ABM |
1.0 ug DNA |
EUR 154 |
Edc4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3355404 |
ABM |
1.0 ug DNA |
EUR 154 |
EDC4 Protein Vector (Mouse) (pPB-C-His) |
PV174466 |
ABM |
500 ng |
EUR 2370 |
EDC4 Protein Vector (Mouse) (pPB-N-His) |
PV174467 |
ABM |
500 ng |
EUR 2370 |
EDC4 Protein Vector (Mouse) (pPM-C-HA) |
PV174468 |
ABM |
500 ng |
EUR 2370 |
EDC4 Protein Vector (Mouse) (pPM-C-His) |
PV174469 |
ABM |
500 ng |
EUR 2370 |
EDC4 Protein Vector (Rat) (pPB-C-His) |
PV265394 |
ABM |
500 ng |
EUR 2396 |
EDC4 Protein Vector (Rat) (pPB-N-His) |
PV265395 |
ABM |
500 ng |
EUR 2396 |
EDC4 Protein Vector (Rat) (pPM-C-HA) |
PV265396 |
ABM |
500 ng |
EUR 2396 |
EDC4 Protein Vector (Rat) (pPM-C-His) |
PV265397 |
ABM |
500 ng |
EUR 2396 |
EDC4 Protein Vector (Human) (pPB-C-His) |
PV013541 |
ABM |
500 ng |
EUR 329 |
EDC4 Protein Vector (Human) (pPB-N-His) |
PV013542 |
ABM |
500 ng |
EUR 329 |
EDC4 Protein Vector (Human) (pPM-C-HA) |
PV013543 |
ABM |
500 ng |
EUR 329 |
EDC4 Protein Vector (Human) (pPM-C-His) |
PV013544 |
ABM |
500 ng |
EUR 329 |
Edc4 3'UTR GFP Stable Cell Line |
TU155595 |
ABM |
1.0 ml |
Ask for price |
Edc4 3'UTR Luciferase Stable Cell Line |
TU105595 |
ABM |
1.0 ml |
Ask for price |
Edc4 3'UTR Luciferase Stable Cell Line |
TU203774 |
ABM |
1.0 ml |
Ask for price |
Edc4 3'UTR GFP Stable Cell Line |
TU253774 |
ABM |
1.0 ml |
Ask for price |
EDC4 3'UTR GFP Stable Cell Line |
TU056554 |
ABM |
1.0 ml |
EUR 1394 |
EDC4 3'UTR Luciferase Stable Cell Line |
TU006554 |
ABM |
1.0 ml |
EUR 1394 |
EDC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV665557 |
ABM |
1.0 ug DNA |
EUR 2241 |
EDC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV665561 |
ABM |
1.0 ug DNA |
EUR 2241 |
EDC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV665562 |
ABM |
1.0 ug DNA |
EUR 2241 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
EDC4 Rabbit Polyclonal Antibody