EDEM3 Rabbit Polyclonal Antibody

EDEM3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

Polyclonal EDEM3 Antibody

AMM07005G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications:

EDEM3 Polyclonal Antibody

ES9649-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Polyclonal Antibody

ES9649-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

EDEM3 Antibody

45972-100ul 100ul
EUR 252

EDEM3 Antibody

45972-50ul 50ul
EUR 187

EDEM3 Antibody

DF9504 200ul
EUR 304
Description: EDEM3 Antibody detects endogenous levels of total EDEM3.

EDEM3 Antibody

ABD9504 100 ug
EUR 438

EDEM3 Conjugated Antibody

C45972 100ul
EUR 397

Anti-EDEM3 antibody

STJ190807 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EDEM3

EDEM3 siRNA

20-abx914952
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 siRNA

20-abx914953
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EDEM3 Blocking Peptide

3614BP-50
EUR 153

EDEM3 Blocking Peptide

DF9504-BP 1mg
EUR 195

EDEM3 cloning plasmid

CSB-CL863170HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
  • Show more
Description: A cloning plasmid for the EDEM3 gene.

Mouse Edem3 ELISA KIT

ELI-26645m 96 Tests
EUR 865

Mouse EDEM3 shRNA Plasmid

20-abx975889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 shRNA Plasmid

20-abx962830
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EDEM3 ELISA KIT

ELI-47172h 96 Tests
EUR 824

Edem3 ORF Vector (Rat) (pORF)

ORF066352 1.0 ug DNA
EUR 506

EDEM3 ORF Vector (Human) (pORF)

ORF003388 1.0 ug DNA
EUR 95

Edem3 ORF Vector (Mouse) (pORF)

ORF043621 1.0 ug DNA
EUR 506

EDEM3 sgRNA CRISPR Lentivector set (Human)

K0653601 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Rat)

K6190401 3 x 1.0 ug
EUR 339

Edem3 sgRNA CRISPR Lentivector set (Mouse)

K3468201 3 x 1.0 ug
EUR 339

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0653602 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0653603 1.0 ug DNA
EUR 154

EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0653604 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6190402 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6190403 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6190404 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3468202 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3468203 1.0 ug DNA
EUR 154

Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3468204 1.0 ug DNA
EUR 154

EDEM3 Protein Vector (Mouse) (pPB-C-His)

PV174482 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPB-N-His)

PV174483 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-HA)

PV174484 500 ng
EUR 1065

EDEM3 Protein Vector (Mouse) (pPM-C-His)

PV174485 500 ng
EUR 1065

EDEM3 Protein Vector (Rat) (pPB-C-His)

PV265406 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPB-N-His)

PV265407 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-HA)

PV265408 500 ng
EUR 1166

EDEM3 Protein Vector (Rat) (pPM-C-His)

PV265409 500 ng
EUR 1166

EDEM3 Protein Vector (Human) (pPB-C-His)

PV013549 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPB-N-His)

PV013550 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-HA)

PV013551 500 ng
EUR 329

EDEM3 Protein Vector (Human) (pPM-C-His)

PV013552 500 ng
EUR 329

Edem3 3'UTR GFP Stable Cell Line

TU155599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU105599 1.0 ml Ask for price

Edem3 3'UTR Luciferase Stable Cell Line

TU203778 1.0 ml Ask for price

Edem3 3'UTR GFP Stable Cell Line

TU253778 1.0 ml Ask for price

EDEM3 3'UTR GFP Stable Cell Line

TU056561 1.0 ml
EUR 2333

EDEM3 3'UTR Luciferase Stable Cell Line

TU006561 1.0 ml
EUR 2333

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

20-abx215068
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody

abx028901-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

EDEM3 Rabbit Polyclonal Antibody