EDEM3 Rabbit Polyclonal Antibody
EDEM3 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
Polyclonal EDEM3 Antibody |
AMM07005G |
Leading Biology |
0.1mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EDEM3 . This antibody is tested and proven to work in the following applications: |
EDEM3 Polyclonal Antibody |
ES9649-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EDEM3 Polyclonal Antibody |
ES9649-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EDEM3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
EDEM3 Antibody |
45972-100ul |
SAB |
100ul |
EUR 252 |
EDEM3 Antibody |
45972-50ul |
SAB |
50ul |
EUR 187 |
EDEM3 Antibody |
DF9504 |
Affbiotech |
200ul |
EUR 304 |
Description: EDEM3 Antibody detects endogenous levels of total EDEM3. |
EDEM3 Conjugated Antibody |
C45972 |
SAB |
100ul |
EUR 397 |
Anti-EDEM3 antibody |
STJ190807 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EDEM3 |
EDEM3 siRNA |
20-abx914952 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDEM3 siRNA |
20-abx914953 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EDEM3 Blocking Peptide |
3614BP-50 |
Biovision |
|
EUR 153 |
EDEM3 Blocking Peptide |
DF9504-BP |
Affbiotech |
1mg |
EUR 195 |
EDEM3 cloning plasmid |
CSB-CL863170HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 369
- Sequence: atgggaggctttaagtatggtgatgaacaaccacgttctgactggcgtagttatcgtaggaatctggagcatgctgtgttagaattgaccttgtttaaaactgtcccatcaaaaatggaaatccacagttcccccttcaaatgcagcactgcaccaccctgcaacacctcaggcca
- Show more
|
Description: A cloning plasmid for the EDEM3 gene. |
Mouse EDEM3 shRNA Plasmid |
20-abx975889 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EDEM3 shRNA Plasmid |
20-abx962830 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Edem3 ORF Vector (Rat) (pORF) |
ORF066352 |
ABM |
1.0 ug DNA |
EUR 506 |
EDEM3 ORF Vector (Human) (pORF) |
ORF003388 |
ABM |
1.0 ug DNA |
EUR 95 |
Edem3 ORF Vector (Mouse) (pORF) |
ORF043621 |
ABM |
1.0 ug DNA |
EUR 506 |
EDEM3 sgRNA CRISPR Lentivector set (Human) |
K0653601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Edem3 sgRNA CRISPR Lentivector set (Rat) |
K6190401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Edem3 sgRNA CRISPR Lentivector set (Mouse) |
K3468201 |
ABM |
3 x 1.0 ug |
EUR 339 |
EDEM3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0653602 |
ABM |
1.0 ug DNA |
EUR 154 |
EDEM3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0653603 |
ABM |
1.0 ug DNA |
EUR 154 |
EDEM3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0653604 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6190402 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6190403 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6190404 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3468202 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3468203 |
ABM |
1.0 ug DNA |
EUR 154 |
Edem3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3468204 |
ABM |
1.0 ug DNA |
EUR 154 |
EDEM3 Protein Vector (Mouse) (pPB-C-His) |
PV174482 |
ABM |
500 ng |
EUR 1065 |
EDEM3 Protein Vector (Mouse) (pPB-N-His) |
PV174483 |
ABM |
500 ng |
EUR 1065 |
EDEM3 Protein Vector (Mouse) (pPM-C-HA) |
PV174484 |
ABM |
500 ng |
EUR 1065 |
EDEM3 Protein Vector (Mouse) (pPM-C-His) |
PV174485 |
ABM |
500 ng |
EUR 1065 |
EDEM3 Protein Vector (Rat) (pPB-C-His) |
PV265406 |
ABM |
500 ng |
EUR 1166 |
EDEM3 Protein Vector (Rat) (pPB-N-His) |
PV265407 |
ABM |
500 ng |
EUR 1166 |
EDEM3 Protein Vector (Rat) (pPM-C-HA) |
PV265408 |
ABM |
500 ng |
EUR 1166 |
EDEM3 Protein Vector (Rat) (pPM-C-His) |
PV265409 |
ABM |
500 ng |
EUR 1166 |
EDEM3 Protein Vector (Human) (pPB-C-His) |
PV013549 |
ABM |
500 ng |
EUR 329 |
EDEM3 Protein Vector (Human) (pPB-N-His) |
PV013550 |
ABM |
500 ng |
EUR 329 |
EDEM3 Protein Vector (Human) (pPM-C-HA) |
PV013551 |
ABM |
500 ng |
EUR 329 |
EDEM3 Protein Vector (Human) (pPM-C-His) |
PV013552 |
ABM |
500 ng |
EUR 329 |
Edem3 3'UTR GFP Stable Cell Line |
TU155599 |
ABM |
1.0 ml |
Ask for price |
Edem3 3'UTR Luciferase Stable Cell Line |
TU105599 |
ABM |
1.0 ml |
Ask for price |
Edem3 3'UTR Luciferase Stable Cell Line |
TU203778 |
ABM |
1.0 ml |
Ask for price |
Edem3 3'UTR GFP Stable Cell Line |
TU253778 |
ABM |
1.0 ml |
Ask for price |
EDEM3 3'UTR GFP Stable Cell Line |
TU056561 |
ABM |
1.0 ml |
EUR 2333 |
EDEM3 3'UTR Luciferase Stable Cell Line |
TU006561 |
ABM |
1.0 ml |
EUR 2333 |
ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
20-abx215068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
abx028901-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ER Degradation-Enhancing Alpha-Mannosidase-Like Protein 3 (EDEM3) Antibody |
abx028901-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
EDEM3 Rabbit Polyclonal Antibody