EIF3A Rabbit Polyclonal Antibody
EIF3A Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
EIF3A Polyclonal Antibody |
ABP58469-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein |
EIF3A Polyclonal Antibody |
ABP58469-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein |
EIF3A Polyclonal Antibody |
ABP58469-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EIF3A protein
- Applications tips:
|
Description: A polyclonal antibody for detection of EIF3A from Human, Mouse, Rat. This EIF3A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EIF3A protein |
EIF3A Rabbit pAb |
A0573-100ul |
Abclonal |
100 ul |
EUR 308 |
EIF3A Rabbit pAb |
A0573-200ul |
Abclonal |
200 ul |
EUR 459 |
EIF3A Rabbit pAb |
A0573-20ul |
Abclonal |
20 ul |
EUR 183 |
EIF3A Rabbit pAb |
A0573-50ul |
Abclonal |
50 ul |
EUR 223 |
EIF3A Antibody |
45975-100ul |
SAB |
100ul |
EUR 252 |
EIF3A Antibody |
45975-50ul |
SAB |
50ul |
EUR 187 |
EIF3A Antibody |
DF9510 |
Affbiotech |
200ul |
EUR 304 |
Description: EIF3A Antibody detects endogenous levels of total EIF3A. |
EIF3A Antibody |
1-CSB-PA623903LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Rabbit EIF3A ELISA Kit |
ERTE0054 |
Abclonal |
96Tests |
EUR 521 |
EIF3A Conjugated Antibody |
C45975 |
SAB |
100ul |
EUR 397 |
Anti-EIF3A antibody |
STJ190814 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EIF3A |
EIF3A siRNA |
20-abx901678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF3A siRNA |
20-abx915160 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF3A siRNA |
20-abx915161 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Eif3a |
YF-PA25156 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Eif3a |
EIF3A Antibody, HRP conjugated |
1-CSB-PA623903LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EIF3A Antibody, FITC conjugated |
1-CSB-PA623903LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EIF3A Antibody, Biotin conjugated |
1-CSB-PA623903LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EIF3A. Recognizes EIF3A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EIF3A Blocking Peptide |
DF9510-BP |
Affbiotech |
1mg |
EUR 195 |
EIF3A cloning plasmid |
CSB-CL623903HU-10ug |
Cusabio |
10ug |
EUR 1629 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4149
- Sequence: ATGCCGGCCTATTTTCAGAGGCCGGAAAATGCCCTCAAACGCGCCAACGAATTTCTTGAGGTTGGCAAAAAGCAGCCTGCTCTGGATGTTCTTTATGATGTTATGAAAAGTAAAAAACATAGAACATGGCAAAAGATACACGAACCAATTATGTTGAAATACTTGGAACTTTGCG
- Show more
|
Description: A cloning plasmid for the EIF3A gene. |
Anti-Eif3a (2G4) |
YF-MA16469 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Eif3a |
Rat EIF3A shRNA Plasmid |
20-abx988556 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EIF3A ELISA Kit |
EHE0054 |
Abclonal |
96Tests |
EUR 521 |
Goat EIF3A ELISA Kit |
EGTE0054 |
Abclonal |
96Tests |
EUR 521 |
Canine EIF3A ELISA Kit |
ECE0054 |
Abclonal |
96Tests |
EUR 521 |
Bovine EIF3A ELISA Kit |
EBE0054 |
Abclonal |
96Tests |
EUR 521 |
Anserini EIF3A ELISA Kit |
EAE0054 |
Abclonal |
96Tests |
EUR 521 |
Porcine EIF3A ELISA Kit |
EPE0054 |
Abclonal |
96Tests |
EUR 521 |
Rat EIF3A ELISA Kit |
ERE0054 |
Abclonal |
96Tests |
EUR 521 |
Mouse EIF3A ELISA Kit |
EME0054 |
Abclonal |
96Tests |
EUR 521 |
Human EIF3A shRNA Plasmid |
20-abx955696 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EIF3A shRNA Plasmid |
20-abx970142 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse) |
4-PAB885Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A) |
Rabbit Eukaryotic Translation Initiation Factor 3a (eIF3a) ELISA Kit |
abx363133-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), APC |
4-PAB885Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with APC. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAB885Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with Biotin. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAB885Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with Cy3. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), FITC |
4-PAB885Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with FITC. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), HRP |
4-PAB885Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with HRP. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), PE |
4-PAB885Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with PE. |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Antibody |
20-abx104335 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody |
20-abx005944 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody |
20-abx215114 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody |
20-abx302524 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody |
20-abx225157 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Guinea Pig EIF3A ELISA Kit |
EGE0054 |
Abclonal |
96Tests |
EUR 521 |
Eif3a ORF Vector (Rat) (pORF) |
ORF066448 |
ABM |
1.0 ug DNA |
EUR 2080 |
Eif3a ORF Vector (Mouse) (pORF) |
ORF043757 |
ABM |
1.0 ug DNA |
EUR 1572 |
EIF3A ORF Vector (Human) (pORF) |
ORF012910 |
ABM |
1.0 ug DNA |
EUR 354 |
EIF3A ELISA Kit (Human) (OKEH01347) |
OKEH01347 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23 ng/mL |
EIF3A ELISA Kit (Mouse) (OKEI00448) |
OKEI00448 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is required for several steps in the initiation of protein synthesis. The eIF-3 complex associates with the 40S ribosome and facilitates the recruitment of eIF-1, eIF-1A, eIF-2:GTP:methionyl-tRNAi and eIF-5 to form the 43S pre-initiation complex (43S PIC). The eIF-3 complex stimulates mRNA recruitment to the 43S PIC and scanning of the mRNA for AUG recognition. The eIF-3 complex is also required for disassembly and recycling of post-termination ribosomal complexes and subsequently prevents premature joining of the 40S and 60S ribosomal subunits prior to initiation. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation, including cell cycling, differentiation and apoptosis, and uses different modes of RNA stem-loop binding to exert either translational activation or repression.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL |
Eukaryotic Translation Initiation Factor 3A (EIF3A) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAB885Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EIF3A (Glu622~Val848)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A). This antibody is labeled with APC-Cy7. |
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (HRP) |
20-abx317408 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (FITC) |
20-abx317409 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 3a (EIF3A) Antibody (Biotin) |
20-abx317410 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
EIF3A sgRNA CRISPR Lentivector set (Human) |
K0667001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif3a sgRNA CRISPR Lentivector set (Mouse) |
K3834701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eif3a sgRNA CRISPR Lentivector set (Rat) |
K6605701 |
ABM |
3 x 1.0 ug |
EUR 339 |
EIF3A sgRNA CRISPR Lentivector (Human) (Target 1) |
K0667002 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF3A sgRNA CRISPR Lentivector (Human) (Target 2) |
K0667003 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF3A sgRNA CRISPR Lentivector (Human) (Target 3) |
K0667004 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3834702 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3834703 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3834704 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6605702 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6605703 |
ABM |
1.0 ug DNA |
EUR 154 |
Eif3a sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6605704 |
ABM |
1.0 ug DNA |
EUR 154 |
EIF3A Protein Vector (Human) (pPB-C-His) |
PV051637 |
ABM |
500 ng |
EUR 481 |
EIF3A Protein Vector (Human) (pPB-N-His) |
PV051638 |
ABM |
500 ng |
EUR 481 |
EIF3A Protein Vector (Human) (pPM-C-HA) |
PV051639 |
ABM |
500 ng |
EUR 481 |
EIF3A Protein Vector (Human) (pPM-C-His) |
PV051640 |
ABM |
500 ng |
EUR 481 |
Recombinant Eukaryotic Translation Initiation Factor 3A (EIF3A) |
4-RPB885Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P23116
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.3kDa
- Isoelectric Point: 6.2
|
Description: Recombinant Mouse Eukaryotic Translation Initiation Factor 3A expressed in: E.coli |
EIF3A Protein Vector (Mouse) (pPB-C-His) |
PV175026 |
ABM |
500 ng |
EUR 2300 |
EIF3A Protein Vector (Mouse) (pPB-N-His) |
PV175027 |
ABM |
500 ng |
EUR 2300 |
EIF3A Protein Vector (Mouse) (pPM-C-HA) |
PV175028 |
ABM |
500 ng |
EUR 2300 |
EIF3A Protein Vector (Mouse) (pPM-C-His) |
PV175029 |
ABM |
500 ng |
EUR 2300 |
EIF3A Protein Vector (Rat) (pPB-C-His) |
PV265790 |
ABM |
500 ng |
EUR 2315 |
EIF3A Protein Vector (Rat) (pPB-N-His) |
PV265791 |
ABM |
500 ng |
EUR 2315 |
EIF3A Protein Vector (Rat) (pPM-C-HA) |
PV265792 |
ABM |
500 ng |
EUR 2315 |
EIF3A Protein Vector (Rat) (pPM-C-His) |
PV265793 |
ABM |
500 ng |
EUR 2315 |
Eif3a 3'UTR Luciferase Stable Cell Line |
TU203880 |
ABM |
1.0 ml |
Ask for price |
Eif3a 3'UTR GFP Stable Cell Line |
TU155713 |
ABM |
1.0 ml |
Ask for price |
EIF3A 3'UTR Luciferase Stable Cell Line |
TU006728 |
ABM |
1.0 ml |
EUR 1394 |
Eif3a 3'UTR Luciferase Stable Cell Line |
TU105713 |
ABM |
1.0 ml |
Ask for price |
EIF3A 3'UTR GFP Stable Cell Line |
TU056728 |
ABM |
1.0 ml |
EUR 1394 |
Eif3a 3'UTR GFP Stable Cell Line |
TU253880 |
ABM |
1.0 ml |
Ask for price |
Mouse Eukaryotic Translation Initiation Factor 3A (EIF3A) Protein |
20-abx066468 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
EIF3A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV704469 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF3A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV704473 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF3A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV704474 |
ABM |
1.0 ug DNA |
EUR 450 |
EIF3A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV689131 |
ABM |
1.0 ug DNA |
EUR 2168 |
EIF3A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV689135 |
ABM |
1.0 ug DNA |
EUR 2168 |
EIF3A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV689136 |
ABM |
1.0 ug DNA |
EUR 2168 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
EIF3A Rabbit Polyclonal Antibody