FANCL Rabbit Polyclonal Antibody
FANCL Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
FANCL Polyclonal Antibody |
ABP58527-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FANCL protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FANCL from Human, Mouse. This FANCL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FANCL protein |
FANCL Polyclonal Antibody |
A69263 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
FANCL Rabbit pAb |
A6812-100ul |
Abclonal |
100 ul |
EUR 308 |
FANCL Rabbit pAb |
A6812-200ul |
Abclonal |
200 ul |
EUR 459 |
FANCL Rabbit pAb |
A6812-20ul |
Abclonal |
20 ul |
EUR 183 |
FANCL Rabbit pAb |
A6812-50ul |
Abclonal |
50 ul |
EUR 223 |
FANCL antibody |
70R-3410 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal FANCL antibody raised against the middle region of FANCL |
FANCL Antibody |
45951-100ul |
SAB |
100ul |
EUR 252 |
FANCL Antibody |
45951-50ul |
SAB |
50ul |
EUR 187 |
FANCL antibody |
70R-17237 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FANCL antibody |
FANCL Antibody |
DF9476 |
Affbiotech |
200ul |
EUR 304 |
Description: FANCL Antibody detects endogenous levels of total FANCL. |
FANCL Antibody |
1-CSB-PA882120LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500 |
FANCL Antibody |
1-CSB-PA008421GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
FANCL Polyclonal Antibody, HRP Conjugated |
A69264 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
FANCL Polyclonal Antibody, FITC Conjugated |
A69265 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
FANCL Polyclonal Antibody, Biotin Conjugated |
A69266 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
FANCL Conjugated Antibody |
C45951 |
SAB |
100ul |
EUR 397 |
anti- FANCL antibody |
FNab03010 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200 - 1:2000
- IHC: 1:20 - 1:200
- Immunogen: Fanconi anemia, complementation group L
- Uniprot ID: Q9NW38
- Gene ID: 55120
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against FANCL |
anti- FANCL antibody |
FNab03011 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Fanconi anemia, complementation group L
- Uniprot ID: Q9NW38
- Gene ID: 55120
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against FANCL |
Anti-FANCL antibody |
STJ28895 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group L. Alternative splicing results in two transcript variants encoding different isoforms. |
Anti-FANCL antibody |
STJ190780 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FANCL |
FANCL siRNA |
20-abx916474 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FANCL siRNA |
20-abx916475 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FANCL |
YF-PA19555 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FANCL |
anti-FANCL |
YF-PA19556 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to FANCL |
anti-FANCL |
YF-PA19557 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FANCL |
anti-FANCL |
YF-PA19558 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to FANCL |
anti-FANCL |
YF-PA19559 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to FANCL |
FANCL Antibody, HRP conjugated |
1-CSB-PA882120LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
FANCL Antibody, FITC conjugated |
1-CSB-PA882120LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
FANCL Antibody, Biotin conjugated |
1-CSB-PA882120LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
FANCL Blocking Peptide |
33R-1506 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FANCL antibody, catalog no. 70R-3410 |
FANCL cloning plasmid |
CSB-CL882120HU-10ug |
Cusabio |
10ug |
EUR 426 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1128
- Sequence: atggcggtgacggaagcgagcctgttgcgccagtgccccctgcttctgccccagaaccggtcgaaaaccgtgtatgagggattcatctcggctcagggaagagacttccaccttaggatagtgttgcctgaagatttacaactgaagaatgcaagattattatgtagttggcagc
- Show more
|
Description: A cloning plasmid for the FANCL gene. |
FANCL Blocking Peptide |
DF9476-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse E3 ubiquitin- protein ligase FANCL, Fancl ELISA KIT |
ELI-09515m |
Lifescience Market |
96 Tests |
EUR 865 |
Human E3 ubiquitin- protein ligase FANCL, FANCL ELISA KIT |
ELI-30782h |
Lifescience Market |
96 Tests |
EUR 824 |
Fancl ELISA Kit| Mouse E3 ubiquitin-protein ligase FANCL ELISA |
EF014872 |
Lifescience Market |
96 Tests |
EUR 689 |
Mouse FANCL shRNA Plasmid |
20-abx975930 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FANCL shRNA Plasmid |
20-abx960483 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FANCL Recombinant Protein (Human) |
RP011758 |
ABM |
100 ug |
Ask for price |
FANCL Recombinant Protein (Rat) |
RP200837 |
ABM |
100 ug |
Ask for price |
FANCL Recombinant Protein (Mouse) |
RP133736 |
ABM |
100 ug |
Ask for price |
Fanconi Anemia Complementation Group L (FANCL) Antibody |
20-abx112461 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
20-abx123129 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
abx031058-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
abx031058-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
20-abx215298 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
20-abx333706 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
abx432088-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
abx233010-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody |
abx233011-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
FANCL ORF Vector (Human) (pORF) |
ORF003920 |
ABM |
1.0 ug DNA |
EUR 95 |
Fancl ORF Vector (Rat) (pORF) |
ORF066947 |
ABM |
1.0 ug DNA |
EUR 506 |
Fancl ORF Vector (Mouse) (pORF) |
ORF044580 |
ABM |
1.0 ug DNA |
EUR 506 |
Fanconi Anemia Complementation Group L (FANCL) Antibody (HRP) |
20-abx335487 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody (FITC) |
20-abx335488 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Fanconi Anemia Complementation Group L (FANCL) Antibody (Biotin) |
20-abx335489 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
FANCL sgRNA CRISPR Lentivector set (Human) |
K0757301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fancl sgRNA CRISPR Lentivector set (Mouse) |
K3831001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fancl sgRNA CRISPR Lentivector set (Rat) |
K6191301 |
ABM |
3 x 1.0 ug |
EUR 339 |
FANCL sgRNA CRISPR Lentivector (Human) (Target 1) |
K0757302 |
ABM |
1.0 ug DNA |
EUR 154 |
FANCL sgRNA CRISPR Lentivector (Human) (Target 2) |
K0757303 |
ABM |
1.0 ug DNA |
EUR 154 |
FANCL sgRNA CRISPR Lentivector (Human) (Target 3) |
K0757304 |
ABM |
1.0 ug DNA |
EUR 154 |
Fancl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3831002 |
ABM |
1.0 ug DNA |
EUR 154 |
FANCL Rabbit Polyclonal Antibody