FANCL Rabbit Polyclonal Antibody

FANCL Rabbit Polyclonal Antibody

Order Now:

FANCL Polyclonal Antibody

ABP58527-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FANCL protein
  • Applications tips:
Description: A polyclonal antibody for detection of FANCL from Human, Mouse. This FANCL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FANCL protein

FANCL Polyclonal Antibody

A69263 100 ?g
EUR 628.55
Description: Ask the seller for details

FANCL Rabbit pAb

A6812-100ul 100 ul
EUR 308

FANCL Rabbit pAb

A6812-200ul 200 ul
EUR 459

FANCL Rabbit pAb

A6812-20ul 20 ul
EUR 183

FANCL Rabbit pAb

A6812-50ul 50 ul
EUR 223

FANCL Antibody

ABD9476 100 ug
EUR 438

FANCL antibody

70R-3410 50 ug
EUR 467
Description: Rabbit polyclonal FANCL antibody raised against the middle region of FANCL

FANCL Antibody

45951-100ul 100ul
EUR 252

FANCL Antibody

45951-50ul 50ul
EUR 187

FANCL antibody

70R-17237 50 ul
EUR 435
Description: Rabbit polyclonal FANCL antibody

FANCL Antibody

DF9476 200ul
EUR 304
Description: FANCL Antibody detects endogenous levels of total FANCL.

FANCL Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:200-1:500

FANCL Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FANCL Polyclonal Antibody, HRP Conjugated

A69264 100 ?g
EUR 628.55
Description: The best epigenetics products

FANCL Polyclonal Antibody, FITC Conjugated

A69265 100 ?g
EUR 628.55
Description: kits suitable for this type of research

FANCL Polyclonal Antibody, Biotin Conjugated

A69266 100 ?g
EUR 628.55
Description: fast delivery possible

FANCL Conjugated Antibody

C45951 100ul
EUR 397

anti- FANCL antibody

FNab03010 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:20 - 1:200
  • Immunogen: Fanconi anemia, complementation group L
  • Uniprot ID: Q9NW38
  • Gene ID: 55120
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against FANCL

anti- FANCL antibody

FNab03011 100µg
EUR 548.75
  • Immunogen: Fanconi anemia, complementation group L
  • Uniprot ID: Q9NW38
  • Gene ID: 55120
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against FANCL

Anti-FANCL antibody

PAab03010 100 ug
EUR 355

Anti-FANCL antibody

PAab03011 100 ug
EUR 386

Anti-FANCL antibody

STJ72280 100 µg
EUR 359

Anti-FANCL antibody

STJ28895 100 µl
EUR 277
Description: The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group L. Alternative splicing results in two transcript variants encoding different isoforms.

Anti-FANCL antibody

STJ190780 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FANCL


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA19555 50 ug
EUR 363
Description: Mouse polyclonal to FANCL


YF-PA19556 50 ul
EUR 363
Description: Mouse polyclonal to FANCL


YF-PA19557 50 ug
EUR 363
Description: Mouse polyclonal to FANCL


YF-PA19558 100 ul
EUR 403
Description: Rabbit polyclonal to FANCL


YF-PA19559 100 ug
EUR 403
Description: Rabbit polyclonal to FANCL

FANCL Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FANCL Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FANCL Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FANCL. Recognizes FANCL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FANCL Blocking Peptide

33R-1506 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FANCL antibody, catalog no. 70R-3410

FANCL cloning plasmid

CSB-CL882120HU-10ug 10ug
EUR 426
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1128
  • Sequence: atggcggtgacggaagcgagcctgttgcgccagtgccccctgcttctgccccagaaccggtcgaaaaccgtgtatgagggattcatctcggctcagggaagagacttccaccttaggatagtgttgcctgaagatttacaactgaagaatgcaagattattatgtagttggcagc
  • Show more
Description: A cloning plasmid for the FANCL gene.

FANCL Blocking Peptide

DF9476-BP 1mg
EUR 195

Mouse E3 ubiquitin- protein ligase FANCL, Fancl ELISA KIT

ELI-09515m 96 Tests
EUR 865

Human E3 ubiquitin- protein ligase FANCL, FANCL ELISA KIT

ELI-30782h 96 Tests
EUR 824

Fancl ELISA Kit| Mouse E3 ubiquitin-protein ligase FANCL ELISA

EF014872 96 Tests
EUR 689

Mouse FANCL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF009559 96 Tests
EUR 689

Human FANCL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FANCL Recombinant Protein (Human)

RP011758 100 ug Ask for price


PVT17889 2 ug
EUR 258

FANCL Recombinant Protein (Rat)

RP200837 100 ug Ask for price

FANCL Recombinant Protein (Mouse)

RP133736 100 ug Ask for price

Fanconi Anemia Complementation Group L (FANCL) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

abx031058-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

abx031058-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

abx432088-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

abx233010-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody

abx233011-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FANCL ORF Vector (Human) (pORF)

ORF003920 1.0 ug DNA
EUR 95

Fancl ORF Vector (Rat) (pORF)

ORF066947 1.0 ug DNA
EUR 506

Fancl ORF Vector (Mouse) (pORF)

ORF044580 1.0 ug DNA
EUR 506

Fanconi Anemia Complementation Group L (FANCL) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fanconi Anemia Complementation Group L (FANCL) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FANCL sgRNA CRISPR Lentivector set (Human)

K0757301 3 x 1.0 ug
EUR 339

Fancl sgRNA CRISPR Lentivector set (Mouse)

K3831001 3 x 1.0 ug
EUR 339

Fancl sgRNA CRISPR Lentivector set (Rat)

K6191301 3 x 1.0 ug
EUR 339

FANCL sgRNA CRISPR Lentivector (Human) (Target 1)

K0757302 1.0 ug DNA
EUR 154

FANCL sgRNA CRISPR Lentivector (Human) (Target 2)

K0757303 1.0 ug DNA
EUR 154

FANCL sgRNA CRISPR Lentivector (Human) (Target 3)

K0757304 1.0 ug DNA
EUR 154

Fancl sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3831002 1.0 ug DNA
EUR 154

FANCL Rabbit Polyclonal Antibody