FNBP4 Rabbit Polyclonal Antibody
FNBP4 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
FNBP4 Polyclonal Antibody |
ABP58579-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FNBP4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of FNBP4 from Human, Mouse. This FNBP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FNBP4 protein |
FNBP4 Polyclonal Antibody |
ES9664-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against FNBP4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FNBP4 Polyclonal Antibody |
ES9664-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against FNBP4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
FNBP4 Rabbit pAb |
A13804-100ul |
Abclonal |
100 ul |
EUR 308 |
FNBP4 Rabbit pAb |
A13804-200ul |
Abclonal |
200 ul |
EUR 459 |
FNBP4 Rabbit pAb |
A13804-20ul |
Abclonal |
20 ul |
EUR 183 |
FNBP4 Rabbit pAb |
A13804-50ul |
Abclonal |
50 ul |
EUR 223 |
FNBP4 Antibody |
45983-100ul |
SAB |
100ul |
EUR 252 |
FNBP4 Antibody |
45983-50ul |
SAB |
50ul |
EUR 187 |
FNBP4 Antibody |
DF9521 |
Affbiotech |
200ul |
EUR 304 |
Description: FNBP4 Antibody detects endogenous levels of total FNBP4. |
FNBP4 Conjugated Antibody |
C45983 |
SAB |
100ul |
EUR 397 |
Anti-FNBP4 antibody |
STJ190822 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to FNBP4 |
FNBP4 siRNA |
20-abx917032 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FNBP4 siRNA |
20-abx917033 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FNBP4 Blocking Peptide |
DF9521-BP |
Affbiotech |
1mg |
EUR 195 |
FNBP4 cloning plasmid |
CSB-CL822699HU-10ug |
Cusabio |
10ug |
EUR 1094 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3048
- Sequence: atggggaagaagtcccgggcggtacccggccgtaggcccatcctgcaactctctccgccgggtcctcggggcagcacgccgggccgggacccggagccggaacccgacactgagccggactcaaccgcggcggtccccagccagcccgccccgtcggcggcgacgaccaccgcgg
- Show more
|
Description: A cloning plasmid for the FNBP4 gene. |
Mouse FNBP4 shRNA Plasmid |
20-abx974558 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FNBP4 shRNA Plasmid |
20-abx958209 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Formin Binding Protein 4 (FNBP4) Antibody |
20-abx215312 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fnbp4 ORF Vector (Rat) (pORF) |
ORF067203 |
ABM |
1.0 ug DNA |
EUR 506 |
FNBP4 ORF Vector (Human) (pORF) |
ORF004136 |
ABM |
1.0 ug DNA |
EUR 95 |
Fnbp4 ORF Vector (Mouse) (pORF) |
ORF044976 |
ABM |
1.0 ug DNA |
EUR 506 |
Fnbp4 sgRNA CRISPR Lentivector set (Mouse) |
K4778001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fnbp4 sgRNA CRISPR Lentivector set (Rat) |
K7363101 |
ABM |
3 x 1.0 ug |
EUR 339 |
FNBP4 sgRNA CRISPR Lentivector set (Human) |
K0791501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4778002 |
ABM |
1.0 ug DNA |
EUR 154 |
Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4778003 |
ABM |
1.0 ug DNA |
EUR 154 |
Fnbp4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4778004 |
ABM |
1.0 ug DNA |
EUR 154 |
Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7363102 |
ABM |
1.0 ug DNA |
EUR 154 |
Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7363103 |
ABM |
1.0 ug DNA |
EUR 154 |
Fnbp4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7363104 |
ABM |
1.0 ug DNA |
EUR 154 |
FNBP4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0791502 |
ABM |
1.0 ug DNA |
EUR 154 |
FNBP4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0791503 |
ABM |
1.0 ug DNA |
EUR 154 |
FNBP4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0791504 |
ABM |
1.0 ug DNA |
EUR 154 |
FNBP4 Protein Vector (Mouse) (pPB-C-His) |
PV179902 |
ABM |
500 ng |
EUR 1065 |
FNBP4 Protein Vector (Mouse) (pPB-N-His) |
PV179903 |
ABM |
500 ng |
EUR 1065 |
FNBP4 Protein Vector (Mouse) (pPM-C-HA) |
PV179904 |
ABM |
500 ng |
EUR 1065 |
FNBP4 Protein Vector (Mouse) (pPM-C-His) |
PV179905 |
ABM |
500 ng |
EUR 1065 |
FNBP4 Protein Vector (Rat) (pPB-C-His) |
PV268810 |
ABM |
500 ng |
EUR 1191 |
FNBP4 Protein Vector (Rat) (pPB-N-His) |
PV268811 |
ABM |
500 ng |
EUR 1191 |
FNBP4 Protein Vector (Rat) (pPM-C-HA) |
PV268812 |
ABM |
500 ng |
EUR 1191 |
FNBP4 Protein Vector (Rat) (pPM-C-His) |
PV268813 |
ABM |
500 ng |
EUR 1191 |
FNBP4 Protein Vector (Human) (pPB-C-His) |
PV016541 |
ABM |
500 ng |
EUR 329 |
FNBP4 Protein Vector (Human) (pPB-N-His) |
PV016542 |
ABM |
500 ng |
EUR 329 |
FNBP4 Protein Vector (Human) (pPM-C-HA) |
PV016543 |
ABM |
500 ng |
EUR 329 |
FNBP4 Protein Vector (Human) (pPM-C-His) |
PV016544 |
ABM |
500 ng |
EUR 329 |
Fnbp4 3'UTR GFP Stable Cell Line |
TU156649 |
ABM |
1.0 ml |
Ask for price |
Fnbp4 3'UTR Luciferase Stable Cell Line |
TU106649 |
ABM |
1.0 ml |
Ask for price |
Fnbp4 3'UTR Luciferase Stable Cell Line |
TU204710 |
ABM |
1.0 ml |
Ask for price |
Fnbp4 3'UTR GFP Stable Cell Line |
TU254710 |
ABM |
1.0 ml |
Ask for price |
FNBP4 3'UTR GFP Stable Cell Line |
TU058063 |
ABM |
1.0 ml |
EUR 1394 |
FNBP4 3'UTR Luciferase Stable Cell Line |
TU008063 |
ABM |
1.0 ml |
EUR 1394 |
Human Formin- binding protein 4, FNBP4 ELISA KIT |
ELI-27517h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Formin Binding Protein 4 (FNBP4) ELISA Kit |
abx384921-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Formin Binding Protein 4 (FNBP4) ELISA Kit |
abx389327-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Formin- binding protein 4, Fnbp4 ELISA KIT |
ELI-32518m |
Lifescience Market |
96 Tests |
EUR 865 |
FNBP4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV634201 |
ABM |
1.0 ug DNA |
EUR 1355 |
FNBP4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV634205 |
ABM |
1.0 ug DNA |
EUR 1355 |
FNBP4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV634206 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
FNBP4 Rabbit Polyclonal Antibody