FYCO1 Rabbit Polyclonal Antibody
FYCO1 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 FYCO1 Polyclonal Antibody |
|
ABP58600-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human FYCO1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FYCO1 from Human. This FYCO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FYCO1 protein |
FYCO1 Polyclonal Antibody |
|
ABP58600-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FYCO1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of FYCO1 from Human. This FYCO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FYCO1 protein |
FYCO1 Polyclonal Antibody |
|
A59174 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 FYCO1 Antibody |
|
AF0388 |
Affbiotech |
200ul |
EUR 304 |
|
Description: FYCO1 antibody detects endogenous levels of total FYCO1. |
FYCO1 Antibody |
|
34690-100ul |
SAB |
100ul |
EUR 252 |
FYCO1 Antibody |
|
34690-50ul |
SAB |
50ul |
EUR 187 |
FYCO1 Antibody |
|
1-CSB-PA866262LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
FYCO1 Antibody |
|
CSB-PA796500- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
FYCO1 Antibody |
|
CSB-PA796500-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
 FYCO1 Polyclonal Antibody, Biotin Conjugated |
|
A59175 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 FYCO1 Polyclonal Antibody, FITC Conjugated |
|
A59176 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 FYCO1 Polyclonal Antibody, HRP Conjugated |
|
A59177 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 FYCO1 Conjugated Antibody |
|
C34690 |
SAB |
100ul |
EUR 397 |
 Anti-FYCO1 antibody |
|
STJ190823 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to FYCO1 |
 FYCO1 siRNA |
|
20-abx917350 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FYCO1 siRNA |
|
20-abx917351 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-FYCO1 |
|
YF-PA20804 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Anti-FYCO1 |
 FYCO1 Antibody, HRP conjugated |
|
1-CSB-PA866262LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 FYCO1 Antibody, FITC conjugated |
|
1-CSB-PA866262LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 FYCO1 Antibody, Biotin conjugated |
|
1-CSB-PA866262LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
|
|
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 FYCO1 Blocking Peptide |
|
AF0388-BP |
Affbiotech |
1mg |
EUR 195 |
 FYCO1 cloning plasmid |
|
CSB-CL866262HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 768
- Sequence: atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgac
- Show more
|
|
Description: A cloning plasmid for the FYCO1 gene. |
FYCO1 cloning plasmid |
|
CSB-CL866262HU2-10ug |
Cusabio |
10ug |
EUR 1734 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4437
- Sequence: atggcctccaccaatgcagagagccagctccagagaatcatccgagacttgcaagatgctgtgacagaactaagcaaagaatttcaggaagcaggggaacccatcacggatgacagcaccagcttgcataaattttcttataaacttgagtatctcctgcaatttgatcagaaag
- Show more
|
|
Description: A cloning plasmid for the FYCO1 gene. |
 anti-Anti-FYCO1 |
|
YF-PA26607 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to Anti-FYCO1 |
 Mouse FYCO1 shRNA Plasmid |
|
20-abx971490 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human FYCO1 shRNA Plasmid |
|
20-abx962385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 (pORF)) FYCO1 ORF Vector (Human) (pORF) |
|
ORF004239 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Fyco1 ORF Vector (Rat) (pORF) |
|
ORF067318 |
ABM |
1.0 ug DNA |
EUR 2080 |
 (pORF)) Fyco1 ORF Vector (Mouse) (pORF) |
|
ORF045174 |
ABM |
1.0 ug DNA |
EUR 1572 |
Fyco1 ORF Vector (Mouse) (pORF) |
|
ORF045175 |
ABM |
1.0 ug DNA |
EUR 1572 |
FYCO1 ORF Vector (Human) (pORF) |
|
ORF013110 |
ABM |
1.0 ug DNA |
EUR 354 |
) Fyco1 sgRNA CRISPR Lentivector set (Mouse) |
|
K4639701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) FYCO1 sgRNA CRISPR Lentivector set (Human) |
|
K0825001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Fyco1 sgRNA CRISPR Lentivector set (Rat) |
|
K6545301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 Antibody) FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody |
|
abx122892-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody |
|
20-abx014479 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
 Antibody) FYVE and Coiled-Coil Domain Containing 1 (FYCO1) Antibody |
|
abx330962-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody |
|
20-abx318419 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (Target 1)) Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4639702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4639703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4639704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) FYCO1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0825002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) FYCO1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0825003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) FYCO1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0825004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6545302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6545303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6545304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) FYCO1 Protein Vector (Human) (pPB-C-His) |
|
PV052437 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) FYCO1 Protein Vector (Human) (pPB-N-His) |
|
PV052438 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) FYCO1 Protein Vector (Human) (pPM-C-HA) |
|
PV052439 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) FYCO1 Protein Vector (Human) (pPM-C-His) |
|
PV052440 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) FYCO1 Protein Vector (Rat) (pPB-C-His) |
|
PV269270 |
ABM |
500 ng |
EUR 2463 |
 (pPB-N-His)) FYCO1 Protein Vector (Rat) (pPB-N-His) |
|
PV269271 |
ABM |
500 ng |
EUR 2463 |
 (pPM-C-HA)) FYCO1 Protein Vector (Rat) (pPM-C-HA) |
|
PV269272 |
ABM |
500 ng |
EUR 2463 |
 (pPM-C-His)) FYCO1 Protein Vector (Rat) (pPM-C-His) |
|
PV269273 |
ABM |
500 ng |
EUR 2463 |
 (pPB-C-His)) FYCO1 Protein Vector (Mouse) (pPB-C-His) |
|
PV180694 |
ABM |
500 ng |
EUR 2443 |
 (pPB-N-His)) FYCO1 Protein Vector (Mouse) (pPB-N-His) |
|
PV180695 |
ABM |
500 ng |
EUR 2443 |
 (pPM-C-HA)) FYCO1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV180696 |
ABM |
500 ng |
EUR 2443 |
 (pPM-C-His)) FYCO1 Protein Vector (Mouse) (pPM-C-His) |
|
PV180697 |
ABM |
500 ng |
EUR 2443 |
FYCO1 Protein Vector (Mouse) (pPB-C-His) |
|
PV180698 |
ABM |
500 ng |
EUR 2443 |
FYCO1 Protein Vector (Mouse) (pPB-N-His) |
|
PV180699 |
ABM |
500 ng |
EUR 2443 |
FYCO1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV180700 |
ABM |
500 ng |
EUR 2443 |
FYCO1 Protein Vector (Mouse) (pPM-C-His) |
|
PV180701 |
ABM |
500 ng |
EUR 2443 |
FYCO1 Protein Vector (Human) (pPB-C-His) |
|
PV016953 |
ABM |
500 ng |
EUR 329 |
FYCO1 Protein Vector (Human) (pPB-N-His) |
|
PV016954 |
ABM |
500 ng |
EUR 329 |
FYCO1 Protein Vector (Human) (pPM-C-HA) |
|
PV016955 |
ABM |
500 ng |
EUR 329 |
FYCO1 Protein Vector (Human) (pPM-C-His) |
|
PV016956 |
ABM |
500 ng |
EUR 329 |
 Fyco1 3'UTR Luciferase Stable Cell Line |
|
TU204852 |
ABM |
1.0 ml |
Ask for price |
 Fyco1 3'UTR GFP Stable Cell Line |
|
TU156805 |
ABM |
1.0 ml |
Ask for price |
 FYCO1 3'UTR Luciferase Stable Cell Line |
|
TU008418 |
ABM |
1.0 ml |
EUR 2333 |
Fyco1 3'UTR Luciferase Stable Cell Line |
|
TU106805 |
ABM |
1.0 ml |
Ask for price |
 FYCO1 3'UTR GFP Stable Cell Line |
|
TU058418 |
ABM |
1.0 ml |
EUR 2333 |
Fyco1 3'UTR GFP Stable Cell Line |
|
TU254852 |
ABM |
1.0 ml |
Ask for price |
 Antibody (HRP)) FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (HRP) |
|
20-abx310892 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (FITC) |
|
20-abx310893 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (Biotin) |
|
20-abx310894 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (CMV) (pLenti-GIII-CMV)) FYCO1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV702093 |
ABM |
1.0 ug DNA |
EUR 450 |
 (UbC) (pLenti-GIII-UbC)) FYCO1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV702097 |
ABM |
1.0 ug DNA |
EUR 450 |
 (EF1a) (pLenti-GIII-EF1a)) FYCO1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV702098 |
ABM |
1.0 ug DNA |
EUR 450 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FYCO1 Rabbit Polyclonal Antibody
