FYCO1 Rabbit Polyclonal Antibody

FYCO1 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

FYCO1 Polyclonal Antibody

ABP58600-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FYCO1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FYCO1 from Human. This FYCO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FYCO1 protein

FYCO1 Polyclonal Antibody

ABP58600-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FYCO1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of FYCO1 from Human. This FYCO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FYCO1 protein

FYCO1 Polyclonal Antibody

A59174 100 µg
EUR 570.55
Description: reagents widely cited

FYCO1 Antibody

AF0388 200ul
EUR 304
Description: FYCO1 antibody detects endogenous levels of total FYCO1.

FYCO1 Antibody

ABF0388 100 ug
EUR 438

FYCO1 Antibody

34690-100ul 100ul
EUR 252

FYCO1 Antibody

34690-50ul 50ul
EUR 187

FYCO1 Antibody

1-CSB-PA866262LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FYCO1 Antibody

CSB-PA796500-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FYCO1 Antibody

CSB-PA796500-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FYCO1 Polyclonal Antibody, Biotin Conjugated

A59175 100 µg
EUR 570.55
Description: Ask the seller for details

FYCO1 Polyclonal Antibody, FITC Conjugated

A59176 100 µg
EUR 570.55
Description: The best epigenetics products

FYCO1 Polyclonal Antibody, HRP Conjugated

A59177 100 µg
EUR 570.55
Description: kits suitable for this type of research

FYCO1 Conjugated Antibody

C34690 100ul
EUR 397

Anti-FYCO1 antibody

STJ190823 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FYCO1

FYCO1 siRNA

20-abx917350
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FYCO1 siRNA

20-abx917351
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-FYCO1

YF-PA20804 50 ug
EUR 363
Description: Mouse polyclonal to Anti-FYCO1

FYCO1 Antibody, HRP conjugated

1-CSB-PA866262LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FYCO1 Antibody, FITC conjugated

1-CSB-PA866262LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FYCO1 Antibody, Biotin conjugated

1-CSB-PA866262LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 Antigen Affinity Purified
Description: A polyclonal antibody against FYCO1. Recognizes FYCO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FYCO1 Blocking Peptide

AF0388-BP 1mg
EUR 195

FYCO1 cloning plasmid

CSB-CL866262HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 768
  • Sequence: atgaacaccaaagtgaccagtgactggtactatgcaagaagcccctttctgcagccaaagctgagctcggacattgtgggccaactctatgagctgactgaggttcagtttgacctggcgtcgaggggctttgacttggatgctgcctggccaacatttgccaggaggacgctgac
  • Show more
Description: A cloning plasmid for the FYCO1 gene.

FYCO1 cloning plasmid

CSB-CL866262HU2-10ug 10ug
EUR 1734
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4437
  • Sequence: atggcctccaccaatgcagagagccagctccagagaatcatccgagacttgcaagatgctgtgacagaactaagcaaagaatttcaggaagcaggggaacccatcacggatgacagcaccagcttgcataaattttcttataaacttgagtatctcctgcaatttgatcagaaag
  • Show more
Description: A cloning plasmid for the FYCO1 gene.

anti-Anti-FYCO1

YF-PA26607 50 ul
EUR 334
Description: Mouse polyclonal to Anti-FYCO1

Human FYCO1 ELISA KIT

ELI-20746h 96 Tests
EUR 824

Mouse Fyco1 ELISA KIT

ELI-20747m 96 Tests
EUR 865

FYCO1 ELISA KIT|Human

EF005019 96 Tests
EUR 689

Mouse FYCO1 shRNA Plasmid

20-abx971490
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FYCO1 shRNA Plasmid

20-abx962385
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FYCO1 ORF Vector (Human) (pORF)

ORF004239 1.0 ug DNA
EUR 95

Fyco1 ORF Vector (Rat) (pORF)

ORF067318 1.0 ug DNA
EUR 2080

Fyco1 ORF Vector (Mouse) (pORF)

ORF045174 1.0 ug DNA
EUR 1572

Fyco1 ORF Vector (Mouse) (pORF)

ORF045175 1.0 ug DNA
EUR 1572

FYCO1 ORF Vector (Human) (pORF)

ORF013110 1.0 ug DNA
EUR 354

Fyco1 sgRNA CRISPR Lentivector set (Mouse)

K4639701 3 x 1.0 ug
EUR 339

FYCO1 sgRNA CRISPR Lentivector set (Human)

K0825001 3 x 1.0 ug
EUR 339

Fyco1 sgRNA CRISPR Lentivector set (Rat)

K6545301 3 x 1.0 ug
EUR 339

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody

abx122892-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody

20-abx014479
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

FYVE and Coiled-Coil Domain Containing 1 (FYCO1) Antibody

abx330962-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody

20-abx318419
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4639702 1.0 ug DNA
EUR 154

Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4639703 1.0 ug DNA
EUR 154

Fyco1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4639704 1.0 ug DNA
EUR 154

FYCO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0825002 1.0 ug DNA
EUR 154

FYCO1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0825003 1.0 ug DNA
EUR 154

FYCO1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0825004 1.0 ug DNA
EUR 154

Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6545302 1.0 ug DNA
EUR 154

Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6545303 1.0 ug DNA
EUR 154

Fyco1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6545304 1.0 ug DNA
EUR 154

FYCO1 Protein Vector (Human) (pPB-C-His)

PV052437 500 ng
EUR 481

FYCO1 Protein Vector (Human) (pPB-N-His)

PV052438 500 ng
EUR 481

FYCO1 Protein Vector (Human) (pPM-C-HA)

PV052439 500 ng
EUR 481

FYCO1 Protein Vector (Human) (pPM-C-His)

PV052440 500 ng
EUR 481

FYCO1 Protein Vector (Rat) (pPB-C-His)

PV269270 500 ng
EUR 2463

FYCO1 Protein Vector (Rat) (pPB-N-His)

PV269271 500 ng
EUR 2463

FYCO1 Protein Vector (Rat) (pPM-C-HA)

PV269272 500 ng
EUR 2463

FYCO1 Protein Vector (Rat) (pPM-C-His)

PV269273 500 ng
EUR 2463

FYCO1 Protein Vector (Mouse) (pPB-C-His)

PV180694 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPB-N-His)

PV180695 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPM-C-HA)

PV180696 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPM-C-His)

PV180697 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPB-C-His)

PV180698 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPB-N-His)

PV180699 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPM-C-HA)

PV180700 500 ng
EUR 2443

FYCO1 Protein Vector (Mouse) (pPM-C-His)

PV180701 500 ng
EUR 2443

FYCO1 Protein Vector (Human) (pPB-C-His)

PV016953 500 ng
EUR 329

FYCO1 Protein Vector (Human) (pPB-N-His)

PV016954 500 ng
EUR 329

FYCO1 Protein Vector (Human) (pPM-C-HA)

PV016955 500 ng
EUR 329

FYCO1 Protein Vector (Human) (pPM-C-His)

PV016956 500 ng
EUR 329

Fyco1 3'UTR Luciferase Stable Cell Line

TU204852 1.0 ml Ask for price

Fyco1 3'UTR GFP Stable Cell Line

TU156805 1.0 ml Ask for price

FYCO1 3'UTR Luciferase Stable Cell Line

TU008418 1.0 ml
EUR 2333

Fyco1 3'UTR Luciferase Stable Cell Line

TU106805 1.0 ml Ask for price

FYCO1 3'UTR GFP Stable Cell Line

TU058418 1.0 ml
EUR 2333

Fyco1 3'UTR GFP Stable Cell Line

TU254852 1.0 ml Ask for price

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (HRP)

20-abx310892
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (FITC)

20-abx310893
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYVE And Coiled-Coil Domain Containing 1 (FYCO1) Antibody (Biotin)

20-abx310894
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

FYCO1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702093 1.0 ug DNA
EUR 450

FYCO1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702097 1.0 ug DNA
EUR 450

FYCO1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702098 1.0 ug DNA
EUR 450

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

FYCO1 Rabbit Polyclonal Antibody