GALM Rabbit Polyclonal Antibody
GALM Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GALM Polyclonal Antibody |
ES9376-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GALM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GALM Polyclonal Antibody |
ABP58606-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120 |
GALM Polyclonal Antibody |
ABP58606-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120 |
GALM Polyclonal Antibody |
ABP58606-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120 |
GALM Polyclonal Antibody |
A55591 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GALM Rabbit pAb |
A14362-100ul |
Abclonal |
100 ul |
EUR 308 |
GALM Rabbit pAb |
A14362-200ul |
Abclonal |
200 ul |
EUR 459 |
GALM Rabbit pAb |
A14362-20ul |
Abclonal |
20 ul |
EUR 183 |
GALM Rabbit pAb |
A14362-50ul |
Abclonal |
50 ul |
EUR 223 |
GALM antibody |
70R-3966 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GALM antibody |
GALM antibody |
70R-4149 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GALM antibody |
GALM Antibody |
45759-100ul |
SAB |
100ul |
EUR 252 |
GALM Antibody |
45759-50ul |
SAB |
50ul |
EUR 187 |
GALM antibody |
70R-17411 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GALM antibody |
GALM Antibody |
DF9191 |
Affbiotech |
200ul |
EUR 304 |
Description: GALM Antibody detects endogenous levels of total GALM. |
GALM Antibody |
1-CSB-PA850268HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GALM. Recognizes GALM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
GALM Antibody |
1-CSB-PA009200GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GALM. Recognizes GALM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
GALM Polyclonal Antibody, HRP Conjugated |
A55592 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GALM Polyclonal Antibody, FITC Conjugated |
A55593 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
GALM Polyclonal Antibody, Biotin Conjugated |
A55594 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
GALM Conjugated Antibody |
C45759 |
SAB |
100ul |
EUR 397 |
anti- GALM antibody |
FNab03321 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: galactose mutarotase(aldose 1-epimerase)
- Uniprot ID: Q96C23
- Gene ID: 130589
- Research Area: Metabolism
|
Description: Antibody raised against GALM |
Human GALM Antibody |
32979-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GALM antibody |
STJ116574 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose. |
Anti-GALM antibody |
STJ190534 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GALM |
GALM siRNA |
20-abx902077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GALM siRNA |
20-abx917514 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GALM siRNA |
20-abx917515 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GALM Antibody, HRP conjugated |
1-CSB-PA850268HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GALM Antibody, FITC conjugated |
1-CSB-PA850268HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GALM Antibody, Biotin conjugated |
1-CSB-PA850268HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rabbit Aldose 1 epimerase(GALM) ELISA kit |
E04A1870-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aldose 1 epimerase(GALM) ELISA kit |
E04A1870-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Aldose 1 epimerase(GALM) ELISA kit |
E04A1870-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
GALM Blocking Peptide |
33R-9947 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALM antibody, catalog no. 70R-4149 |
GALM Blocking Peptide |
33R-8549 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALM antibody, catalog no. 70R-3966 |
GALM Blocking Peptide |
DF9191-BP |
Affbiotech |
1mg |
EUR 195 |
GALM cloning plasmid |
CSB-CL850268HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1029
- Sequence: atggcttcggtgaccagggccgtgtttggagagctgccctcgggaggagggacagtggagaagttccagctgcagtcagacctcttgagagtggacatcatctcctggggctgcacgatcacagccctagaggtcaaagacaggcaggggagagcctcggacgtggtgcttggct
- Show more
|
Description: A cloning plasmid for the GALM gene. |
Aldose 1-Epimerase (GALM) Antibody |
20-abx112656 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody |
20-abx109513 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody |
abx146094-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody |
20-abx215534 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody |
abx233321-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human GALM Antibody (Biotin Conjugate) |
32979-05121 |
AssayPro |
150 ug |
EUR 369 |
Aldose 1-Epimerase (GALM) Antibody (Biotin) |
20-abx105116 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody (FITC) |
20-abx106533 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Aldose 1-Epimerase (GALM) Antibody (HRP) |
20-abx107950 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human GALM AssayLite Antibody (FITC Conjugate) |
32979-05141 |
AssayPro |
150 ug |
EUR 428 |
Human GALM AssayLite Antibody (RPE Conjugate) |
32979-05151 |
AssayPro |
150 ug |
EUR 428 |
Human GALM AssayLite Antibody (APC Conjugate) |
32979-05161 |
AssayPro |
150 ug |
EUR 428 |
Human GALM AssayLite Antibody (PerCP Conjugate) |
32979-05171 |
AssayPro |
150 ug |
EUR 471 |
Rat GALM shRNA Plasmid |
20-abx989796 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GALM shRNA Plasmid |
20-abx983294 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GALM shRNA Plasmid |
20-abx965038 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GALM Rabbit Polyclonal Antibody