GALM Rabbit Polyclonal Antibody

GALM Rabbit Polyclonal Antibody

Order Now:

GALM Polyclonal Antibody
ABP58606-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
GALM Polyclonal Antibody
ABP58606-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
GALM Polyclonal Antibody
ABP58606-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of GALM from Human, Mouse, Rat. This GALM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GALM protein at amino acid sequence of 40-120
GALM Polyclonal Antibody
ES9376-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GALM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GALM Polyclonal Antibody
ES9376-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GALM from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GALM Rabbit pAb
A14362-100ul 100 ul
EUR 308
GALM Rabbit pAb
A14362-200ul 200 ul
EUR 459
GALM Rabbit pAb
A14362-20ul 20 ul
EUR 183
GALM Rabbit pAb
A14362-50ul 50 ul
EUR 223
GALM antibody
70R-17411 50 ul
EUR 435
Description: Rabbit polyclonal GALM antibody
GALM Antibody
45759-100ul 100ul
EUR 252
GALM Antibody
45759-50ul 50ul
EUR 187
GALM Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALM. Recognizes GALM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
GALM Antibody
DF9191 200ul
EUR 304
Description: GALM Antibody detects endogenous levels of total GALM.
GALM antibody
70R-3966 50 ug
EUR 467
Description: Rabbit polyclonal GALM antibody
GALM antibody
70R-4149 50 ug
EUR 467
Description: Rabbit polyclonal GALM antibody
GALM Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GALM. Recognizes GALM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GALM Antibody
ABD9191 100 ug
EUR 438
GALM Polyclonal Antibody, HRP Conjugated
A55592 100 µg
EUR 570.55
Description: reagents widely cited
GALM Polyclonal Antibody, FITC Conjugated
A55593 100 µg
EUR 570.55
Description: Ask the seller for details
GALM Polyclonal Antibody, Biotin Conjugated
A55594 100 µg
EUR 570.55
Description: The best epigenetics products
Human GALM Antibody
32979-05111 150 ug
EUR 261
GALM Conjugated Antibody
C45759 100ul
EUR 397
anti- GALM antibody
FNab03321 100µg
EUR 505.25
  • Immunogen: galactose mutarotase(aldose 1-epimerase)
  • Uniprot ID: Q96C23
  • Gene ID: 130589
  • Research Area: Metabolism
Description: Antibody raised against GALM
Anti-GALM antibody
PAab03321 100 ug
EUR 355
Anti-GALM antibody
STJ116574 100 µl
EUR 277
Description: This gene encodes an enzyme that catalyzes the epimerization of hexose sugars such as glucose and galactose. The encoded protein is expressed in the cytoplasm and has a preference for galactose. The encoded protein may be required for normal galactose metabolism by maintaining the equilibrium of alpha and beta anomers of galactose.
Anti-GALM antibody
STJ190534 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GALM
Galm/ Rat Galm ELISA Kit
ELI-32457r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GALM Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GALM Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GALM Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GALM. Recognizes GALM from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Rabbit Aldose 1 epimerase(GALM) ELISA kit
E04A1870-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Aldose 1 epimerase(GALM) ELISA kit
E04A1870-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Aldose 1 epimerase(GALM) ELISA kit
E04A1870-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Aldose 1 epimerase(GALM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
GALM Blocking Peptide
33R-8549 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALM antibody, catalog no. 70R-3966
GALM Blocking Peptide
33R-9947 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALM antibody, catalog no. 70R-4149
GALM Blocking Peptide
DF9191-BP 1mg
EUR 195
GALM cloning plasmid
CSB-CL850268HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1029
  • Sequence: atggcttcggtgaccagggccgtgtttggagagctgccctcgggaggagggacagtggagaagttccagctgcagtcagacctcttgagagtggacatcatctcctggggctgcacgatcacagccctagaggtcaaagacaggcaggggagagcctcggacgtggtgcttggct
  • Show more
Description: A cloning plasmid for the GALM gene.
PVT13162 2 ug
EUR 391
Human GALM Antibody (Biotin Conjugate)
32979-05121 150 ug
EUR 369
Aldose 1-Epimerase (GALM) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody
abx146094-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody
abx233321-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human GALM AssayLite Antibody (FITC Conjugate)
32979-05141 150 ug
EUR 428
Human GALM AssayLite Antibody (RPE Conjugate)
32979-05151 150 ug
EUR 428
Human GALM AssayLite Antibody (APC Conjugate)
32979-05161 150 ug
EUR 428
Human GALM AssayLite Antibody (PerCP Conjugate)
32979-05171 150 ug
EUR 471
Aldose 1-Epimerase (GALM) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Aldose 1-Epimerase (GALM) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GALM protein (His tag)
80R-1382 100 ug
EUR 305
Description: Purified recombinant Human GALM protein
EF009761 96 Tests
EUR 689
Rat GALM shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALM Rabbit Polyclonal Antibody