GAS2 Rabbit Polyclonal Antibody
GAS2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GAS2 Polyclonal Antibody |
ABP58608-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GAS2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GAS2 from Human, Mouse. This GAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAS2 protein |
GAS2 Polyclonal Antibody |
ABP58608-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GAS2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GAS2 from Human, Mouse. This GAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAS2 protein |
GAS2 Polyclonal Antibody |
ABP58608-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GAS2 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GAS2 from Human, Mouse. This GAS2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GAS2 protein |
GAS2 Polyclonal Antibody |
A62630 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GAS2 Rabbit pAb |
A1168-100ul |
Abclonal |
100 ul |
EUR 308 |
GAS2 Rabbit pAb |
A1168-200ul |
Abclonal |
200 ul |
EUR 459 |
GAS2 Rabbit pAb |
A1168-20ul |
Abclonal |
20 ul |
EUR 183 |
GAS2 Rabbit pAb |
A1168-50ul |
Abclonal |
50 ul |
EUR 223 |
GAS2 Antibody |
32198-100ul |
SAB |
100ul |
EUR 252 |
GAS2 antibody |
70R-17426 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GAS2 antibody |
GAS2 Antibody |
DF6302 |
Affbiotech |
200ul |
EUR 304 |
Description: GAS2 Antibody detects endogenous levels of total GAS2. |
GAS2 Antibody |
1-CSB-PA290331 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
GAS2 Antibody |
1-CSB-PA009265GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
GAS2 Antibody |
1-CSB-PA009265LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000 |
GAS2 Antibody |
1-CSB-PA189397 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
GAS2 Polyclonal Antibody, HRP Conjugated |
A62631 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GAS2 Polyclonal Antibody, FITC Conjugated |
A62632 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
GAS2 Polyclonal Antibody, Biotin Conjugated |
A62633 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
GAS2 Conjugated Antibody |
C32198 |
SAB |
100ul |
EUR 397 |
anti- GAS2 antibody |
FNab03350 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- IF: 1:50 - 1:200
- Immunogen: growth arrest-specific 2
- Uniprot ID: O43903
- Gene ID: 2620
- Research Area: Signal Transduction
|
Description: Antibody raised against GAS2 |
Anti-GAS2 antibody |
STJ23749 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a caspase-3 substrate that plays a role in regulating microfilament and cell shape changes during apoptosis. It can also modulate cell susceptibility to p53-dependent apoptosis by inhibiting calpain activity. Alternative splicing results in multiple transcript variants. |
Anti-GAS2 antibody |
STJ190841 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GAS2 |
GAS2 siRNA |
20-abx917603 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAS2 siRNA |
20-abx917604 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GAS2 |
YF-PA11945 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to GAS2 |
anti-GAS2 |
YF-PA11946 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GAS2 |
anti-GAS2 |
YF-PA23761 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to GAS2 |
GAS2 Antibody, HRP conjugated |
1-CSB-PA009265LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GAS2 Antibody, FITC conjugated |
1-CSB-PA009265LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GAS2 Antibody, Biotin conjugated |
1-CSB-PA009265LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GAS2. Recognizes GAS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GAS2 cloning plasmid |
CSB-CL009265HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 426
- Sequence: atgtgcactgctctgagcccaaaggtacgcagtgggcctggcctctctgatatgcatcagtatagccaatggctagccagcagacatgaagctaatttgctaccaatgaaagaagatctggccttgtggttaaccaatctattagggaaggagattacagcagaaacttttatgga
- Show more
|
Description: A cloning plasmid for the GAS2 gene. |
GAS2 Blocking Peptide |
DF6302-BP |
Affbiotech |
1mg |
EUR 195 |
anti-GAS2 (4E11) |
LF-MA10116 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GAS2 |
Mouse GAS2 shRNA Plasmid |
20-abx970470 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GAS2 shRNA Plasmid |
20-abx951736 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GAS2 Recombinant Protein (Human) |
RP012922 |
ABM |
100 ug |
Ask for price |
GAS2 Recombinant Protein (Rat) |
RP202253 |
ABM |
100 ug |
Ask for price |
GAS2 Recombinant Protein (Mouse) |
RP135935 |
ABM |
100 ug |
Ask for price |
GAS2-Like Protein 1 (GAS2L1) Antibody |
abx117225-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
20-abx001755 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
abx038082-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
abx025646-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
abx025646-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
20-abx321023 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GAS2-Like Protein 1 (GAS2L1) Antibody |
20-abx321923 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat) |
4-PAA201Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2272.00
-
EUR 571.00
-
EUR 288.00
-
EUR 207.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2) |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), APC |
4-PAA201Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2951.00
-
EUR 831.00
-
EUR 407.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with APC. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), Biotinylated |
4-PAA201Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2222.00
-
EUR 668.00
-
EUR 357.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with Biotin. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), Cy3 |
4-PAA201Hu01-Cy3 |
Cloud-Clone |
-
EUR 389.00
-
EUR 3893.00
-
EUR 1067.00
-
EUR 501.00
-
EUR 237.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with Cy3. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), FITC |
4-PAA201Hu01-FITC |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with FITC. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), HRP |
4-PAA201Hu01-HRP |
Cloud-Clone |
-
EUR 296.00
-
EUR 2574.00
-
EUR 737.00
-
EUR 369.00
-
EUR 198.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with HRP. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), PE |
4-PAA201Hu01-PE |
Cloud-Clone |
-
EUR 278.00
-
EUR 2380.00
-
EUR 685.00
-
EUR 346.00
-
EUR 187.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with PE. |
Monoclonal GAS2 Antibody (monoclonal) (M01), Clone: 4E12 |
AMM03570G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human GAS2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E12. This antibody is applicable in WB and IF, E |
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx112854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx001082 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx103339 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1094.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
abx030639-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
abx030639-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
abx215555-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx303935 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx211569 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx211570 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
20-abx225183 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody |
abx233350-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
GAS2 ORF Vector (Human) (pORF) |
ORF004308 |
ABM |
1.0 ug DNA |
EUR 95 |
Gas2 ORF Vector (Rat) (pORF) |
ORF067419 |
ABM |
1.0 ug DNA |
EUR 506 |
Gas2 ORF Vector (Mouse) (pORF) |
ORF045313 |
ABM |
1.0 ug DNA |
EUR 506 |
Recombinant Saccharomyces Cerevisiae GAS2 Protein |
VAng-Wyb4670-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Saccharomyces Cerevisiae Growth Arrest-Specific 2 protein, recombinant protein. |
Growth Arrest Specific Protein 2 (GAS2) Polyclonal Antibody (Human, Rat), APC-Cy7 |
4-PAA201Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 526.00
-
EUR 5782.00
-
EUR 1543.00
-
EUR 695.00
-
EUR 299.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GAS2 (Gly64~Asp267)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat Growth Arrest Specific Protein 2 (GAS2). This antibody is labeled with APC-Cy7. |
Growth Arrest Specific Protein 2 (GAS2) Antibody (HRP) |
20-abx303936 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody (FITC) |
20-abx303937 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Growth Arrest Specific Protein 2 (GAS2) Antibody (Biotin) |
20-abx303938 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gas2 sgRNA CRISPR Lentivector set (Rat) |
K6435101 |
ABM |
3 x 1.0 ug |
EUR 339 |
GAS2 sgRNA CRISPR Lentivector set (Human) |
K0841401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gas2 sgRNA CRISPR Lentivector set (Mouse) |
K3655001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant human GAS2-like protein 3 |
P2394 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q86XJ1
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human GAS2-like protein 3 |
Gas2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6435102 |
ABM |
1.0 ug DNA |
EUR 154 |
Gas2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6435103 |
ABM |
1.0 ug DNA |
EUR 154 |
Gas2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6435104 |
ABM |
1.0 ug DNA |
EUR 154 |
GAS2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0841402 |
ABM |
1.0 ug DNA |
EUR 154 |
GAS2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0841403 |
ABM |
1.0 ug DNA |
EUR 154 |
GAS2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0841404 |
ABM |
1.0 ug DNA |
EUR 154 |
Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3655002 |
ABM |
1.0 ug DNA |
EUR 154 |
Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3655003 |
ABM |
1.0 ug DNA |
EUR 154 |
Gas2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3655004 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Growth Arrest Specific Protein 2 (GAS2) |
4-RPA201Hu01 |
Cloud-Clone |
-
EUR 490.66
-
EUR 234.00
-
EUR 1564.96
-
EUR 588.32
-
EUR 1076.64
-
EUR 391.00
-
EUR 3762.40
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O43903
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 26.5kDa
- Isoelectric Point: 8.7
|
Description: Recombinant Human Growth Arrest Specific Protein 2 expressed in: E.coli |
GAS2 Protein Vector (Rat) (pPB-C-His) |
PV269674 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Rat) (pPB-N-His) |
PV269675 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Rat) (pPM-C-HA) |
PV269676 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Rat) (pPM-C-His) |
PV269677 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Mouse) (pPB-C-His) |
PV181250 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Mouse) (pPB-N-His) |
PV181251 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Mouse) (pPM-C-HA) |
PV181252 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Mouse) (pPM-C-His) |
PV181253 |
ABM |
500 ng |
EUR 603 |
GAS2 Protein Vector (Human) (pPB-C-His) |
PV017229 |
ABM |
500 ng |
EUR 329 |
GAS2 Protein Vector (Human) (pPB-N-His) |
PV017230 |
ABM |
500 ng |
EUR 329 |
GAS2 Protein Vector (Human) (pPM-C-HA) |
PV017231 |
ABM |
500 ng |
EUR 329 |
GAS2 Protein Vector (Human) (pPM-C-His) |
PV017232 |
ABM |
500 ng |
EUR 329 |
Gas2 3'UTR Luciferase Stable Cell Line |
TU204958 |
ABM |
1.0 ml |
Ask for price |
Gas2 3'UTR GFP Stable Cell Line |
TU156916 |
ABM |
1.0 ml |
Ask for price |
GAS2 3'UTR Luciferase Stable Cell Line |
TU008621 |
ABM |
1.0 ml |
EUR 1394 |
Gas2 3'UTR Luciferase Stable Cell Line |
TU106916 |
ABM |
1.0 ml |
Ask for price |
GAS2 3'UTR GFP Stable Cell Line |
TU058621 |
ABM |
1.0 ml |
EUR 1394 |
Gas2 3'UTR GFP Stable Cell Line |
TU254958 |
ABM |
1.0 ml |
Ask for price |
Mouse GAS2- like protein 1, Gas2l1 ELISA KIT |
ELI-26628m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse GAS2- like protein 3, Gas2l3 ELISA KIT |
ELI-07822m |
Lifescience Market |
96 Tests |
EUR 865 |
Human GAS2- like protein 2, GAS2L2 ELISA KIT |
ELI-07926h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse GAS2- like protein 2, Gas2l2 ELISA KIT |
ELI-27166m |
Lifescience Market |
96 Tests |
EUR 865 |
Human GAS2- like protein 3, GAS2L3 ELISA KIT |
ELI-43348h |
Lifescience Market |
96 Tests |
EUR 824 |
Human GAS2- like protein 1, GAS2L1 ELISA KIT |
ELI-48415h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Growth Arrest Specific Protein 2 (GAS2) Protein |
20-abx066927 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2110.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
GAS2 Rabbit Polyclonal Antibody