GEM Rabbit Polyclonal Antibody

GEM Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

GEM Polyclonal Antibody

ABP58630-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GEM protein
  • Applications tips:
Description: A polyclonal antibody for detection of GEM from Human. This GEM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GEM protein

GEM Polyclonal Antibody

ABP58630-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GEM protein
  • Applications tips:
Description: A polyclonal antibody for detection of GEM from Human. This GEM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GEM protein

GEM Polyclonal Antibody

ES9691-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GEM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GEM Polyclonal Antibody

ES9691-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GEM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GEM Rabbit pAb

A7433-100ul 100 ul
EUR 308

GEM Rabbit pAb

A7433-200ul 200 ul
EUR 459

GEM Rabbit pAb

A7433-20ul 20 ul
EUR 183

GEM Rabbit pAb

A7433-50ul 50 ul
EUR 223

GEM Polyclonal Conjugated Antibody

C30925 100ul
EUR 397

GEM antibody

22426-100ul 100ul
EUR 390

GEM antibody

70R-1647 100 ug
EUR 377
Description: Rabbit polyclonal GEM antibody raised against the C terminal of GEM

GEM antibody

70R-17456 50 ul
EUR 435
Description: Rabbit polyclonal GEM antibody

GEM antibody

70R-12514 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GEM antibody

Gem antibody

70R-2035 50 ug
EUR 467
Description: Rabbit polyclonal Gem antibody

GEM Antibody

DF2201 200ul
EUR 304
Description: GEM antibody detects endogenous levels of total GEM.

GEM antibody

70R-5974 50 ug
EUR 467
Description: Rabbit polyclonal GEM antibody raised against the N terminal of GEM

GEM Antibody

1-CSB-PA009362ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GEM. Recognizes GEM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GEM Antibody

1-CSB-PA009362GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GEM. Recognizes GEM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GEM Antibody

ABD13108 100 ug
EUR 438

GEM Antibody

ABD2201 100 ug
EUR 438

GTP Binding Protein GEM (GEM) Antibody

20-abx006949
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody

20-abx112875
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody

abx145808-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody

20-abx320347
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody

abx233418-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

GTP Binding Protein GEM (GEM) Antibody

abx432741-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Anti-GEM antibody

PAab03418 100 ug
EUR 386

Anti-GEM antibody

STJ29569 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified.

Anti-GEM antibody

STJ190849 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GEM

Polyclonal GEM (aa34-46) Antibody (internal region)

APR16125G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GEM (aa34-46) (internal region). This antibody is tested and proven to work in the following applications:

GEM siRNA

20-abx917772
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GEM siRNA

20-abx917773
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GEM

YF-PA27231 50 ug
EUR 363
Description: Mouse polyclonal to GEM

Mouse GTP- binding protein GEM, Gem ELISA KIT

ELI-27281m 96 Tests
EUR 865

Human GTP- binding protein GEM, GEM ELISA KIT

ELI-08167h 96 Tests
EUR 824

Human GTP Binding Protein GEM (GEM) ELISA Kit

abx387530-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse GTP Binding Protein GEM (GEM) ELISA Kit

abx389471-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GEM Blocking Peptide

33R-3073 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEM antibody, catalog no. 70R-1647

GEM Blocking Peptide

33R-4348 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEM antibody, catalog no. 70R-5974

Gem Blocking Peptide

33R-7463 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEMIN4 antibody, catalog no. 70R-2035

GEM Blocking Peptide

DF2201-BP 1mg
EUR 195

GEM cloning plasmid

CSB-CL009362HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atgactctgaataatgtcaccatgcgccagggcactgtgggcatgcagccacagcagcagcgctggagcatcccagctgatggcaggcatctgatggtccagaaagagccccaccagtacagccaccgcaaccgccattctgctacccctgaggaccactgccgccgaagctggtc
  • Show more
Description: A cloning plasmid for the GEM gene.

Anti-GEM (4B12)

YF-MA13221 100 ug
EUR 363
Description: Mouse monoclonal to GEM

GEM-Interacting Protein (GMIP) Antibody

abx037285-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody

abx048483-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody

abx233525-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

GEM-Interacting Protein (GMIP) Antibody

20-abx313889
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-GEM (aa34-46) antibody

STJ72787 100 µg
EUR 359

Gem ELISA Kit| Mouse GTP-binding protein GEM ELISA Kit

EF015105 96 Tests
EUR 689

Gem-associated protein 7 polyclona Antibody

42674-100ul 100ul
EUR 333

Gem Associated Protein 8 (GEMIN8) Antibody

20-abx215593
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

20-abx112697
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody

20-abx112698
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

20-abx112699
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody

abx122891-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

20-abx125874
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody

20-abx125875
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody

20-abx109811
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody

abx145807-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

abx145973-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

abx031434-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

abx031434-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

abx029912-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

abx029912-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

abx233419-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gem Associated Protein 5 (GEMIN5) Antibody

abx233420-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gem Associated Protein 6 (GEMIN6) Antibody

abx233421-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Gem Associated Protein 7 (GEMIN7) Antibody

abx233422-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

abx233423-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gem Associated Protein 8 (GEMIN8) Antibody

20-abx318121
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody

20-abx334171
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody

20-abx301529
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (HRP)

20-abx313890
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (FITC)

20-abx313891
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (Biotin)

20-abx313892
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GEM ELISA KIT|Human

EF009827 96 Tests
EUR 689

Mouse GEM shRNA Plasmid

20-abx970513
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GEM shRNA Plasmid

20-abx951778
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GEM Recombinant Protein (Human)

RP013093 100 ug Ask for price

GEM Recombinant Protein (Rat)

RP202460 100 ug Ask for price

GEM Recombinant Protein (Mouse)

RP136259 100 ug Ask for price

Gem Associated Protein 7 (GEMIN7) Antibody (Biotin)

20-abx105447
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody (FITC)

20-abx106865
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody (HRP)

20-abx108285
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal GEM Antibody (monoclonal) (M01), Clone: 4B12

APR16126G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GEM (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB, E

Gem-associated protein 7 polyclona Conjugated Antibody

C42674 100ul
EUR 397

Gem Associated Protein 6 (GEMIN6) Antibody (HRP)

20-abx309083
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody (FITC)

20-abx309084
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody (Biotin)

20-abx309085
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (HRP)

20-abx335802
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (FITC)

20-abx335803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (Biotin)

20-abx335804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (HRP)

20-abx311262
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (FITC)

20-abx311263
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (Biotin)

20-abx311264
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gem-Associated Protein 6 Protein

20-abx262594
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Gem ORF Vector (Rat) (pORF)

ORF067488 1.0 ug DNA
EUR 506

GEM ORF Vector (Human) (pORF)

ORF004365 1.0 ug DNA
EUR 95

Gem ORF Vector (Mouse) (pORF)

ORF045421 1.0 ug DNA
EUR 506

Gem Nuclear Organelle Associated Protein 2 (Gemin2) Antibody

20-abx007810
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody

20-abx214487
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody

20-abx214694
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody

20-abx115923
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RRAD And GEM Like GTPase 2 (REM2) Antibody

abx122938-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody

20-abx123216
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody

abx237871-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody

20-abx241653
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody

20-abx241654
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RRAD And GEM Like GTPase 2 (REM2) Antibody

abx237237-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody

20-abx002220
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Gem-associated protein 7 (GEMIN7)

1-CSB-EP862039HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gem-associated protein 7(GEMIN7) expressed in E.coli

Gem sgRNA CRISPR Lentivector set (Rat)

K6091801 3 x 1.0 ug
EUR 339

Gem sgRNA CRISPR Lentivector set (Mouse)

K3369301 3 x 1.0 ug
EUR 339

GEM sgRNA CRISPR Lentivector set (Human)

K0851201 3 x 1.0 ug
EUR 339

Recombinant human Gem-associated protein 4

P2652 100ug Ask for price
  • Uniprot ID: P57678
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Gem-associated protein 4

Mouse GEM- interacting protein, Gmip ELISA KIT

ELI-31135m 96 Tests
EUR 865

Human GEM- interacting protein, GMIP ELISA KIT

ELI-31237h 96 Tests
EUR 824

Human GEM-Interacting Protein (GMIP) ELISA Kit

abx387592-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Gem sgRNA CRISPR Lentivector (Rat) (Target 1)

K6091802 1.0 ug DNA
EUR 154

Gem sgRNA CRISPR Lentivector (Rat) (Target 2)

K6091803 1.0 ug DNA
EUR 154

Gem sgRNA CRISPR Lentivector (Rat) (Target 3)

K6091804 1.0 ug DNA
EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3369302 1.0 ug DNA
EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3369303 1.0 ug DNA
EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3369304 1.0 ug DNA
EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 1)

K0851202 1.0 ug DNA
EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 2)

K0851203 1.0 ug DNA
EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 3)

K0851204 1.0 ug DNA
EUR 154

GEM Protein Vector (Rat) (pPB-C-His)

PV269950 500 ng
EUR 603

GEM Protein Vector (Rat) (pPB-N-His)

PV269951 500 ng
EUR 603

GEM Protein Vector (Rat) (pPM-C-HA)

PV269952 500 ng
EUR 603

GEM Protein Vector (Rat) (pPM-C-His)

PV269953 500 ng
EUR 603

GEM Protein Vector (Mouse) (pPB-C-His)

PV181682 500 ng
EUR 603

GEM Protein Vector (Mouse) (pPB-N-His)

PV181683 500 ng
EUR 603

GEM Protein Vector (Mouse) (pPM-C-HA)

PV181684 500 ng
EUR 603

GEM Protein Vector (Mouse) (pPM-C-His)

PV181685 500 ng
EUR 603

GEM Protein Vector (Human) (pPB-C-His)

PV017457 500 ng
EUR 329

GEM Protein Vector (Human) (pPB-N-His)

PV017458 500 ng
EUR 329

GEM Protein Vector (Human) (pPM-C-HA)

PV017459 500 ng
EUR 329

GEM Protein Vector (Human) (pPM-C-His)

PV017460 500 ng
EUR 329

GEM Rabbit Polyclonal Antibody