GEM Rabbit Polyclonal Antibody

GEM Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

GEM Polyclonal Antibody
ABP58630-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GEM protein Applications tips:
Description: A polyclonal antibody for detection of GEM from Human. This GEM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GEM protein

GEM Polyclonal Antibody
ABP58630-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GEM protein Applications tips:
Description: A polyclonal antibody for detection of GEM from Human. This GEM antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GEM protein

GEM Polyclonal Antibody
ES9691-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GEM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GEM Polyclonal Antibody
ES9691-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GEM from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GEM Rabbit pAb
A7433-100ul	Abclonal	100 ul	EUR 308

GEM Rabbit pAb
A7433-200ul	Abclonal	200 ul	EUR 459

GEM Rabbit pAb
A7433-20ul	Abclonal	20 ul	EUR 183

GEM Rabbit pAb
A7433-50ul	Abclonal	50 ul	EUR 223

GEM Polyclonal Conjugated Antibody
C30925	SAB	100ul	EUR 397

GEM antibody
22426-100ul	SAB	100ul	EUR 390

GEM antibody
70R-1647	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal GEM antibody raised against the C terminal of GEM

GEM antibody
70R-17456	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GEM antibody

GEM antibody
70R-12514	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GEM antibody

Gem antibody
70R-2035	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Gem antibody

GEM Antibody
DF2201	Affbiotech	200ul	EUR 304
Description: GEM antibody detects endogenous levels of total GEM.

GEM antibody
70R-5974	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GEM antibody raised against the N terminal of GEM

GEM Antibody
1-CSB-PA009362ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GEM. Recognizes GEM from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GEM Antibody
1-CSB-PA009362GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GEM. Recognizes GEM from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GEM Antibody
ABD13108	Lifescience Market	100 ug	EUR 438

GEM Antibody
ABD2201	Lifescience Market	100 ug	EUR 438

GTP Binding Protein GEM (GEM) Antibody
20-abx006949	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody
20-abx112875	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody
abx145808-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody
20-abx320347	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

GTP Binding Protein GEM (GEM) Antibody
abx233418-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

GTP Binding Protein GEM (GEM) Antibody
abx432741-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Anti-GEM antibody
PAab03418	Lifescience Market	100 ug	EUR 386

Anti-GEM antibody
STJ29569	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified.

Anti-GEM antibody
STJ190849	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GEM

Polyclonal GEM (aa34-46) Antibody (internal region)
APR16125G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GEM (aa34-46) (internal region). This antibody is tested and proven to work in the following applications:

GEM siRNA
20-abx917772	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GEM siRNA
20-abx917773	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GEM
YF-PA27231	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to GEM

Mouse GTP- binding protein GEM, Gem ELISA KIT
ELI-27281m	Lifescience Market	96 Tests	EUR 865

Human GTP- binding protein GEM, GEM ELISA KIT
ELI-08167h	Lifescience Market	96 Tests	EUR 824

Human GTP Binding Protein GEM (GEM) ELISA Kit
abx387530-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse GTP Binding Protein GEM (GEM) ELISA Kit
abx389471-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

GEM Blocking Peptide
33R-3073	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEM antibody, catalog no. 70R-1647

GEM Blocking Peptide
33R-4348	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEM antibody, catalog no. 70R-5974

Gem Blocking Peptide
33R-7463	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GEMIN4 antibody, catalog no. 70R-2035

GEM Blocking Peptide
DF2201-BP	Affbiotech	1mg	EUR 195

GEM cloning plasmid
CSB-CL009362HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 891 Sequence: atgactctgaataatgtcaccatgcgccagggcactgtgggcatgcagccacagcagcagcgctggagcatcccagctgatggcaggcatctgatggtccagaaagagccccaccagtacagccaccgcaaccgccattctgctacccctgaggaccactgccgccgaagctggtc Show more
Description: A cloning plasmid for the GEM gene.

Anti-GEM (4B12)
YF-MA13221	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GEM

GEM-Interacting Protein (GMIP) Antibody
abx037285-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody
abx048483-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody
abx233525-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

GEM-Interacting Protein (GMIP) Antibody
20-abx313889	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-GEM (aa34-46) antibody
STJ72787	St John's Laboratory	100 µg	EUR 359

Gem ELISA Kit| Mouse GTP-binding protein GEM ELISA Kit
EF015105	Lifescience Market	96 Tests	EUR 689

Gem-associated protein 7 polyclona Antibody
42674-100ul	SAB	100ul	EUR 333

Gem Associated Protein 8 (GEMIN8) Antibody
20-abx215593	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
20-abx112697	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody
20-abx112698	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
20-abx112699	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody
abx122891-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
20-abx125874	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody
20-abx125875	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody
20-abx109811	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody
abx145807-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
abx145973-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
abx031434-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
abx031434-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
abx029912-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
abx029912-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
abx233419-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Gem Associated Protein 5 (GEMIN5) Antibody
abx233420-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Gem Associated Protein 6 (GEMIN6) Antibody
abx233421-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Gem Associated Protein 7 (GEMIN7) Antibody
abx233422-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
abx233423-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Gem Associated Protein 8 (GEMIN8) Antibody
20-abx318121	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody
20-abx334171	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody
20-abx301529	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (HRP)
20-abx313890	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (FITC)
20-abx313891	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GEM-Interacting Protein (GMIP) Antibody (Biotin)
20-abx313892	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GEM ELISA KIT|Human
EF009827	Lifescience Market	96 Tests	EUR 689

Mouse GEM shRNA Plasmid
20-abx970513	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GEM shRNA Plasmid
20-abx951778	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GEM Recombinant Protein (Human)
RP013093	ABM	100 ug	Ask for price

GEM Recombinant Protein (Rat)
RP202460	ABM	100 ug	Ask for price

GEM Recombinant Protein (Mouse)
RP136259	ABM	100 ug	Ask for price

Gem Associated Protein 7 (GEMIN7) Antibody (Biotin)
20-abx105447	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody (FITC)
20-abx106865	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 7 (GEMIN7) Antibody (HRP)
20-abx108285	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Monoclonal GEM Antibody (monoclonal) (M01), Clone: 4B12
APR16126G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GEM (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB, E

Gem-associated protein 7 polyclona Conjugated Antibody
C42674	SAB	100ul	EUR 397

Gem Associated Protein 6 (GEMIN6) Antibody (HRP)
20-abx309083	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody (FITC)
20-abx309084	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 6 (GEMIN6) Antibody (Biotin)
20-abx309085	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (HRP)
20-abx335802	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (FITC)
20-abx335803	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 4 (GEMIN4) Antibody (Biotin)
20-abx335804	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (HRP)
20-abx311262	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (FITC)
20-abx311263	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem Associated Protein 8 (GEMIN8) Antibody (Biotin)
20-abx311264	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Gem-Associated Protein 6 Protein
20-abx262594	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Gem ORF Vector (Rat) (pORF)
ORF067488	ABM	1.0 ug DNA	EUR 506

GEM ORF Vector (Human) (pORF)
ORF004365	ABM	1.0 ug DNA	EUR 95

Gem ORF Vector (Mouse) (pORF)
ORF045421	ABM	1.0 ug DNA	EUR 506

Gem Nuclear Organelle Associated Protein 2 (Gemin2) Antibody
20-abx007810	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody
20-abx214487	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody
20-abx214694	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody
20-abx115923	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

RRAD And GEM Like GTPase 2 (REM2) Antibody
abx122938-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody
20-abx123216	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (SIP1) Antibody
abx237871-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody
20-abx241653	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody
20-abx241654	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

RRAD And GEM Like GTPase 2 (REM2) Antibody
abx237237-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Gem Nuclear Organelle Associated Protein 2 (GEMIN2) Antibody
20-abx002220	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Human Gem-associated protein 7 (GEMIN7)
1-CSB-EP862039HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 41.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Gem-associated protein 7(GEMIN7) expressed in E.coli

Gem sgRNA CRISPR Lentivector set (Rat)
K6091801	ABM	3 x 1.0 ug	EUR 339

Gem sgRNA CRISPR Lentivector set (Mouse)
K3369301	ABM	3 x 1.0 ug	EUR 339

GEM sgRNA CRISPR Lentivector set (Human)
K0851201	ABM	3 x 1.0 ug	EUR 339

Recombinant human Gem-associated protein 4
P2652	FN Test	100ug	Ask for price
Uniprot ID: P57678 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Gem-associated protein 4

Mouse GEM- interacting protein, Gmip ELISA KIT
ELI-31135m	Lifescience Market	96 Tests	EUR 865

Human GEM- interacting protein, GMIP ELISA KIT
ELI-31237h	Lifescience Market	96 Tests	EUR 824

Human GEM-Interacting Protein (GMIP) ELISA Kit
abx387592-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Gem sgRNA CRISPR Lentivector (Rat) (Target 1)
K6091802	ABM	1.0 ug DNA	EUR 154

Gem sgRNA CRISPR Lentivector (Rat) (Target 2)
K6091803	ABM	1.0 ug DNA	EUR 154

Gem sgRNA CRISPR Lentivector (Rat) (Target 3)
K6091804	ABM	1.0 ug DNA	EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3369302	ABM	1.0 ug DNA	EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3369303	ABM	1.0 ug DNA	EUR 154

Gem sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3369304	ABM	1.0 ug DNA	EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 1)
K0851202	ABM	1.0 ug DNA	EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 2)
K0851203	ABM	1.0 ug DNA	EUR 154

GEM sgRNA CRISPR Lentivector (Human) (Target 3)
K0851204	ABM	1.0 ug DNA	EUR 154

GEM Protein Vector (Rat) (pPB-C-His)
PV269950	ABM	500 ng	EUR 603

GEM Protein Vector (Rat) (pPB-N-His)
PV269951	ABM	500 ng	EUR 603

GEM Protein Vector (Rat) (pPM-C-HA)
PV269952	ABM	500 ng	EUR 603

GEM Protein Vector (Rat) (pPM-C-His)
PV269953	ABM	500 ng	EUR 603

GEM Protein Vector (Mouse) (pPB-C-His)
PV181682	ABM	500 ng	EUR 603

GEM Protein Vector (Mouse) (pPB-N-His)
PV181683	ABM	500 ng	EUR 603

GEM Protein Vector (Mouse) (pPM-C-HA)
PV181684	ABM	500 ng	EUR 603

GEM Protein Vector (Mouse) (pPM-C-His)
PV181685	ABM	500 ng	EUR 603

GEM Protein Vector (Human) (pPB-C-His)
PV017457	ABM	500 ng	EUR 329

GEM Protein Vector (Human) (pPB-N-His)
PV017458	ABM	500 ng	EUR 329

GEM Protein Vector (Human) (pPM-C-HA)
PV017459	ABM	500 ng	EUR 329

GEM Protein Vector (Human) (pPM-C-His)
PV017460	ABM	500 ng	EUR 329

GEM Rabbit Polyclonal Antibody