GMDS Rabbit Polyclonal Antibody

GMDS Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

GMDS Polyclonal Antibody

ABP58648-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

ABP58648-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

ABP58648-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GMDS protein
  • Applications tips:
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein

GMDS Polyclonal Antibody

A69515 100 ?g
EUR 628.55
Description: fast delivery possible

GMDS Rabbit pAb

A15060-100ul 100 ul
EUR 308

GMDS Rabbit pAb

A15060-200ul 200 ul
EUR 459

GMDS Rabbit pAb

A15060-20ul 20 ul
EUR 183

GMDS Rabbit pAb

A15060-50ul 50 ul
EUR 223

GMDS Antibody

ABD9530 100 ug
EUR 438

GMDS Antibody

45988-100ul 100ul
EUR 252

GMDS Antibody

45988-50ul 50ul
EUR 187

GMDS antibody

10R-4219 100 ul
EUR 726
Description: Mouse monoclonal GMDS antibody

GMDS antibody

70R-17510 50 ul
EUR 435
Description: Rabbit polyclonal GMDS antibody

GMDS antibody

70R-13484 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GMDS antibody

GMDS Antibody

DF9530 200ul
EUR 304
Description: GMDS Antibody detects endogenous levels of total GMDS.

GMDS Antibody

1-CSB-PA009569GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GMDS Antibody

1-CSB-PA009569LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

GMDS Polyclonal Antibody, HRP Conjugated

A69516 100 ?g
EUR 628.55
Description: reagents widely cited

GMDS Polyclonal Antibody, FITC Conjugated

A69517 100 ?g
EUR 628.55
Description: Ask the seller for details

GMDS Polyclonal Antibody, Biotin Conjugated

A69518 100 ?g
EUR 628.55
Description: The best epigenetics products

GMDS Conjugated Antibody

C45988 100ul
EUR 397

anti- GMDS antibody

FNab03521 100µg
EUR 505.25
  • Immunogen: GDP-mannose 4,6-dehydratase
  • Uniprot ID: O60547
  • Gene ID: 2762
  • Research Area: Metabolism
Description: Antibody raised against GMDS

Human GMDS Antibody

32687-05111 150 ug
EUR 261

Anti-GMDS antibody

PAab03521 100 ug
EUR 355

Anti-GMDS antibody

STJ117254 100 µl
EUR 277

Anti-GMDS antibody

STJ190830 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GMDS

GMDS siRNA

20-abx918105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMDS siRNA

20-abx918106
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GMDS

YF-PA12047 100 ug
EUR 403
Description: Rabbit polyclonal to GMDS

anti-GMDS

YF-PA12048 100 ug
EUR 403
Description: Rabbit polyclonal to GMDS

GMDS Antibody, HRP conjugated

1-CSB-PA009569LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMDS Antibody, FITC conjugated

1-CSB-PA009569LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMDS Antibody, Biotin conjugated

1-CSB-PA009569LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GMDS cloning plasmid

CSB-CL009569HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1119
  • Sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagtt
  • Show more
Description: A cloning plasmid for the GMDS gene.

GMDS Blocking Peptide

DF9530-BP 1mg
EUR 195

Human GMDS Antibody (Biotin Conjugate)

32687-05121 150 ug
EUR 369

Mouse GMDS shRNA Plasmid

20-abx981179
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GMDS ELISA KIT|Human

EF009896 96 Tests
EUR 689

Human GMDS shRNA Plasmid

20-abx951834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GMDS Recombinant Protein (Human)

RP013414 100 ug Ask for price

GMDS Recombinant Protein (Rat)

RP202892 100 ug Ask for price

GMDS Recombinant Protein (Mouse)

RP138836 100 ug Ask for price

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx112693
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

abx036013-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx215645
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

20-abx334170
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody

abx233521-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human GMDS AssayLite Antibody (FITC Conjugate)

32687-05141 150 ug
EUR 428

Human GMDS AssayLite Antibody (RPE Conjugate)

32687-05151 150 ug
EUR 428

Human GMDS AssayLite Antibody (APC Conjugate)

32687-05161 150 ug
EUR 428

Human GMDS AssayLite Antibody (PerCP Conjugate)

32687-05171 150 ug
EUR 471

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (HRP)

20-abx335799
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (FITC)

20-abx335800
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (Biotin)

20-abx335801
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GMDS ORF Vector (Human) (pORF)

ORF004472 1.0 ug DNA
EUR 95

Gmds ORF Vector (Rat) (pORF)

ORF067632 1.0 ug DNA
EUR 506

Gmds ORF Vector (Mouse) (pORF)

ORF046280 1.0 ug DNA
EUR 506

GMDS sgRNA CRISPR Lentivector set (Human)

K0872601 3 x 1.0 ug
EUR 339

Gmds sgRNA CRISPR Lentivector set (Mouse)

K4094301 3 x 1.0 ug
EUR 339

Gmds sgRNA CRISPR Lentivector set (Rat)

K7463601 3 x 1.0 ug
EUR 339

GMDS sgRNA CRISPR Lentivector (Human) (Target 1)

K0872602 1.0 ug DNA
EUR 154

GMDS sgRNA CRISPR Lentivector (Human) (Target 2)

K0872603 1.0 ug DNA
EUR 154

GMDS sgRNA CRISPR Lentivector (Human) (Target 3)

K0872604 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4094302 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4094303 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4094304 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Rat) (Target 1)

K7463602 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Rat) (Target 2)

K7463603 1.0 ug DNA
EUR 154

Gmds sgRNA CRISPR Lentivector (Rat) (Target 3)

K7463604 1.0 ug DNA
EUR 154

Recombinant Human GMDS Protein, His, E.coli-1mg

QP12001-1mg 1mg
EUR 2757

Recombinant Human GMDS Protein, His, E.coli-20ug

QP12001-20ug 20ug
EUR 201

Recombinant Human GMDS Protein, His, E.coli-5ug

QP12001-5ug 5ug
EUR 155

GMDS Protein Vector (Rat) (pPB-C-His)

PV270526 500 ng
EUR 603

GMDS Protein Vector (Rat) (pPB-N-His)

PV270527 500 ng
EUR 603

GMDS Protein Vector (Rat) (pPM-C-HA)

PV270528 500 ng
EUR 603

GMDS Protein Vector (Rat) (pPM-C-His)

PV270529 500 ng
EUR 603

GMDS Protein Vector (Mouse) (pPB-C-His)

PV185118 500 ng
EUR 603

GMDS Protein Vector (Mouse) (pPB-N-His)

PV185119 500 ng
EUR 603

GMDS Protein Vector (Mouse) (pPM-C-HA)

PV185120 500 ng
EUR 603

GMDS Protein Vector (Mouse) (pPM-C-His)

PV185121 500 ng
EUR 603

GMDS Protein Vector (Human) (pPB-C-His)

PV017885 500 ng
EUR 329

GMDS Protein Vector (Human) (pPB-N-His)

PV017886 500 ng
EUR 329

GMDS Protein Vector (Human) (pPM-C-HA)

PV017887 500 ng
EUR 329

GMDS Protein Vector (Human) (pPM-C-His)

PV017888 500 ng
EUR 329

Gmds 3'UTR Luciferase Stable Cell Line

TU205187 1.0 ml Ask for price

Gmds 3'UTR GFP Stable Cell Line

TU158828 1.0 ml Ask for price

GMDS 3'UTR Luciferase Stable Cell Line

TU008949 1.0 ml
EUR 1394

Gmds 3'UTR Luciferase Stable Cell Line

TU108828 1.0 ml Ask for price

GMDS 3'UTR GFP Stable Cell Line

TU058949 1.0 ml
EUR 1394

Gmds 3'UTR GFP Stable Cell Line

TU255187 1.0 ml Ask for price

Human GDP- mannose 4,6 dehydratase, GMDS ELISA KIT

ELI-27340h 96 Tests
EUR 824

Mouse GDP- mannose 4,6 dehydratase, Gmds ELISA KIT

ELI-31134m 96 Tests
EUR 865

Human GDP-Mannose 4,6 Dehydratase (GMDS) ELISA Kit

abx387589-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse GDP-Mannose 4,6 Dehydratase (GMDS) ELISA Kit

abx389392-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GMDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637339 1.0 ug DNA
EUR 682

GMDS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637343 1.0 ug DNA
EUR 682

GMDS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637344 1.0 ug DNA
EUR 682

GMDS GDP-Mannose 4,6-Dehydratase Human Recombinant Protein

PROTO60547 Regular: 20ug
EUR 317
Description: GMDS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 392 amino acids (1-372) and having a molecular mass of 44.1 kDa.;GMDS is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GMDS Rabbit Polyclonal Antibody