GMDS Rabbit Polyclonal Antibody
GMDS Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GMDS Polyclonal Antibody |
ABP58648-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GMDS protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein |
GMDS Polyclonal Antibody |
ABP58648-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GMDS protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein |
GMDS Polyclonal Antibody |
ABP58648-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GMDS protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GMDS from Human, Mouse. This GMDS antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GMDS protein |
GMDS Polyclonal Antibody |
A69515 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
GMDS Rabbit pAb |
A15060-100ul |
Abclonal |
100 ul |
EUR 308 |
GMDS Rabbit pAb |
A15060-200ul |
Abclonal |
200 ul |
EUR 459 |
GMDS Rabbit pAb |
A15060-20ul |
Abclonal |
20 ul |
EUR 183 |
GMDS Rabbit pAb |
A15060-50ul |
Abclonal |
50 ul |
EUR 223 |
GMDS Antibody |
45988-100ul |
SAB |
100ul |
EUR 252 |
GMDS Antibody |
45988-50ul |
SAB |
50ul |
EUR 187 |
GMDS antibody |
10R-4219 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal GMDS antibody |
GMDS antibody |
70R-17510 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GMDS antibody |
GMDS antibody |
70R-13484 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal GMDS antibody |
GMDS Antibody |
DF9530 |
Affbiotech |
200ul |
EUR 304 |
Description: GMDS Antibody detects endogenous levels of total GMDS. |
GMDS Antibody |
1-CSB-PA009569GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
GMDS Antibody |
1-CSB-PA009569LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
GMDS Polyclonal Antibody, HRP Conjugated |
A69516 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
GMDS Polyclonal Antibody, FITC Conjugated |
A69517 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
GMDS Polyclonal Antibody, Biotin Conjugated |
A69518 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
GMDS Conjugated Antibody |
C45988 |
SAB |
100ul |
EUR 397 |
anti- GMDS antibody |
FNab03521 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: GDP-mannose 4,6-dehydratase
- Uniprot ID: O60547
- Gene ID: 2762
- Research Area: Metabolism
|
Description: Antibody raised against GMDS |
Human GMDS Antibody |
32687-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GMDS antibody |
STJ190830 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GMDS |
GMDS siRNA |
20-abx918105 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GMDS siRNA |
20-abx918106 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-GMDS |
YF-PA12047 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GMDS |
anti-GMDS |
YF-PA12048 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to GMDS |
GMDS Antibody, HRP conjugated |
1-CSB-PA009569LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GMDS Antibody, FITC conjugated |
1-CSB-PA009569LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GMDS Antibody, Biotin conjugated |
1-CSB-PA009569LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GMDS. Recognizes GMDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GMDS cloning plasmid |
CSB-CL009569HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1119
- Sequence: atggcacacgcaccggcacgctgccccagcgcccggggctccggggacggcgagatgggcaagcccaggaacgtggcgctcatcaccggtatcacaggccaggatggttcctacctggctgagttcctgctggagaaaggctatgaggtccatggaattgtacggcggtccagtt
- Show more
|
Description: A cloning plasmid for the GMDS gene. |
GMDS Blocking Peptide |
DF9530-BP |
Affbiotech |
1mg |
EUR 195 |
Human GMDS Antibody (Biotin Conjugate) |
32687-05121 |
AssayPro |
150 ug |
EUR 369 |
Mouse GMDS shRNA Plasmid |
20-abx981179 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GMDS shRNA Plasmid |
20-abx951834 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GMDS Recombinant Protein (Human) |
RP013414 |
ABM |
100 ug |
Ask for price |
GMDS Recombinant Protein (Rat) |
RP202892 |
ABM |
100 ug |
Ask for price |
GMDS Recombinant Protein (Mouse) |
RP138836 |
ABM |
100 ug |
Ask for price |
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody |
20-abx112693 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody |
abx036013-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody |
20-abx215645 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody |
20-abx334170 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody |
abx233521-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Human GMDS AssayLite Antibody (FITC Conjugate) |
32687-05141 |
AssayPro |
150 ug |
EUR 428 |
Human GMDS AssayLite Antibody (RPE Conjugate) |
32687-05151 |
AssayPro |
150 ug |
EUR 428 |
Human GMDS AssayLite Antibody (APC Conjugate) |
32687-05161 |
AssayPro |
150 ug |
EUR 428 |
Human GMDS AssayLite Antibody (PerCP Conjugate) |
32687-05171 |
AssayPro |
150 ug |
EUR 471 |
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (HRP) |
20-abx335799 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (FITC) |
20-abx335800 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GDP-Mannose 4,6 Dehydratase (GMDS) Antibody (Biotin) |
20-abx335801 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GMDS ORF Vector (Human) (pORF) |
ORF004472 |
ABM |
1.0 ug DNA |
EUR 95 |
Gmds ORF Vector (Rat) (pORF) |
ORF067632 |
ABM |
1.0 ug DNA |
EUR 506 |
Gmds ORF Vector (Mouse) (pORF) |
ORF046280 |
ABM |
1.0 ug DNA |
EUR 506 |
GMDS sgRNA CRISPR Lentivector set (Human) |
K0872601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gmds sgRNA CRISPR Lentivector set (Mouse) |
K4094301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gmds sgRNA CRISPR Lentivector set (Rat) |
K7463601 |
ABM |
3 x 1.0 ug |
EUR 339 |
GMDS sgRNA CRISPR Lentivector (Human) (Target 1) |
K0872602 |
ABM |
1.0 ug DNA |
EUR 154 |
GMDS sgRNA CRISPR Lentivector (Human) (Target 2) |
K0872603 |
ABM |
1.0 ug DNA |
EUR 154 |
GMDS sgRNA CRISPR Lentivector (Human) (Target 3) |
K0872604 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4094302 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4094303 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4094304 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7463602 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7463603 |
ABM |
1.0 ug DNA |
EUR 154 |
Gmds sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7463604 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Human GMDS Protein, His, E.coli-1mg |
QP12001-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human GMDS Protein, His, E.coli-20ug |
QP12001-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human GMDS Protein, His, E.coli-5ug |
QP12001-5ug |
EnQuireBio |
5ug |
EUR 155 |
GMDS Protein Vector (Rat) (pPB-C-His) |
PV270526 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Rat) (pPB-N-His) |
PV270527 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Rat) (pPM-C-HA) |
PV270528 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Rat) (pPM-C-His) |
PV270529 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Mouse) (pPB-C-His) |
PV185118 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Mouse) (pPB-N-His) |
PV185119 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Mouse) (pPM-C-HA) |
PV185120 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Mouse) (pPM-C-His) |
PV185121 |
ABM |
500 ng |
EUR 603 |
GMDS Protein Vector (Human) (pPB-C-His) |
PV017885 |
ABM |
500 ng |
EUR 329 |
GMDS Protein Vector (Human) (pPB-N-His) |
PV017886 |
ABM |
500 ng |
EUR 329 |
GMDS Protein Vector (Human) (pPM-C-HA) |
PV017887 |
ABM |
500 ng |
EUR 329 |
GMDS Protein Vector (Human) (pPM-C-His) |
PV017888 |
ABM |
500 ng |
EUR 329 |
Gmds 3'UTR Luciferase Stable Cell Line |
TU205187 |
ABM |
1.0 ml |
Ask for price |
Gmds 3'UTR GFP Stable Cell Line |
TU158828 |
ABM |
1.0 ml |
Ask for price |
GMDS 3'UTR Luciferase Stable Cell Line |
TU008949 |
ABM |
1.0 ml |
EUR 1394 |
Gmds 3'UTR Luciferase Stable Cell Line |
TU108828 |
ABM |
1.0 ml |
Ask for price |
GMDS 3'UTR GFP Stable Cell Line |
TU058949 |
ABM |
1.0 ml |
EUR 1394 |
Gmds 3'UTR GFP Stable Cell Line |
TU255187 |
ABM |
1.0 ml |
Ask for price |
Human GDP- mannose 4,6 dehydratase, GMDS ELISA KIT |
ELI-27340h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse GDP- mannose 4,6 dehydratase, Gmds ELISA KIT |
ELI-31134m |
Lifescience Market |
96 Tests |
EUR 865 |
Human GDP-Mannose 4,6 Dehydratase (GMDS) ELISA Kit |
abx387589-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse GDP-Mannose 4,6 Dehydratase (GMDS) ELISA Kit |
abx389392-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
GMDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV637339 |
ABM |
1.0 ug DNA |
EUR 682 |
GMDS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV637343 |
ABM |
1.0 ug DNA |
EUR 682 |
GMDS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV637344 |
ABM |
1.0 ug DNA |
EUR 682 |
GMDS GDP-Mannose 4,6-Dehydratase Human Recombinant Protein |
PROTO60547 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: GMDS Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 392 amino acids (1-372) and having a molecular mass of 44.1 kDa.;GMDS is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
GMDS Rabbit Polyclonal Antibody