GNA11 Rabbit Polyclonal Antibody
GNA11 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 GNA11 Polyclonal Antibody |
|
ES9703-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against GNA11 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 GNA11 Rabbit pAb |
|
A2731-100ul |
Abclonal |
100 ul |
EUR 308 |
GNA11 Rabbit pAb |
|
A2731-200ul |
Abclonal |
200 ul |
EUR 459 |
GNA11 Rabbit pAb |
|
A2731-20ul |
Abclonal |
20 ul |
EUR 183 |
GNA11 Rabbit pAb |
|
A2731-50ul |
Abclonal |
50 ul |
EUR 223 |
 GNA11 Antibody |
|
35744-100ul |
SAB |
100ul |
EUR 252 |
 GNA11 antibody |
|
38451-100ul |
SAB |
100ul |
EUR 252 |
GNA11 Antibody |
|
1-CSB-PA135485 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
GNA11 Antibody |
|
DF7067 |
Affbiotech |
200ul |
EUR 304 |
|
Description: GNA11 Antibody detects endogenous levels of total GNA11. |
GNA11 Antibody |
|
1-CSB-PA201320 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
GNA11 Antibody |
|
1-CSB-PA009583LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
) Polyclonal GNA11 Antibody(N-term) |
|
APR14324G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNA11 (N-term). This antibody is tested and proven to work in the following applications: |
 GNA11 Conjugated Antibody |
|
C35744 |
SAB |
100ul |
EUR 397 |
GNA11 Conjugated Antibody |
|
C38451 |
SAB |
100ul |
EUR 397 |
 Anti-GNA11 antibody |
|
STJ23811 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. |
Anti-GNA11 antibody |
|
STJ190861 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to GNA11 |
 GNA11 siRNA |
|
20-abx902208 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GNA11 siRNA |
|
20-abx918132 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GNA11 siRNA |
|
20-abx918133 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-GNA11 |
|
YF-PA12051 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to GNA11 |
 GNA11 Antibody, HRP conjugated |
|
1-CSB-PA009583LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 GNA11 Antibody, FITC conjugated |
|
1-CSB-PA009583LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 GNA11 Antibody, Biotin conjugated |
|
1-CSB-PA009583LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against GNA11. Recognizes GNA11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 GNA11 Blocking Peptide |
|
DF7067-BP |
Affbiotech |
1mg |
EUR 195 |
 GNA11 cloning plasmid |
|
CSB-CL009583HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 513
- Sequence: atggatcgcctgtgctgccttcgcccgccgccacaccgggaccctgcacggctgcttctggcctcgacagatgacaaaagaaacagccccaaaatacgaccactccaaccagcagttcccgcctgcctgcccgccactgtcaggcctgccctggcctcctcgtccgcagggctgtc
- Show more
|
|
Description: A cloning plasmid for the GNA11 gene. |
GNA11 cloning plasmid |
|
CSB-CL009583HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1080
- Sequence: ATGACTCTGGAGTCCATGATGGCGTGTTGCCTGAGCGATGAGGTGAAGGAGTCCAAGCGGATCAACGCCGAGATCGAGAAGCAGCTGCGGCGGGACAAGCGCGACGCCCGGCGCGAGCTCAAGCTGCTGCTGCTCGGCACGGGCGAGAGCGGGAAGAGCACGTTCATCAAGCAGA
- Show more
|
|
Description: A cloning plasmid for the GNA11 gene. |
 Polyclonal Antibody (Human, Rat)) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat) |
|
4-PAF061Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11) |
 Antibody) G Protein Alpha 11 (GNa11) Antibody |
|
20-abx129141 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
G Protein Alpha 11 (GNa11) Antibody |
|
20-abx172489 |
Abbexa |
|
|
|
|
 Antibody) G Protein Alpha 11 (GNA11) Antibody |
|
20-abx242123 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
G Protein Alpha 11 (GNA11) Antibody |
|
20-abx242124 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
G Protein Alpha 11 (GNA11) Antibody |
|
20-abx302215 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
G Protein Alpha 11 (GNA11) Antibody |
|
20-abx225189 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
G Protein Alpha 11 (GNA11) Antibody |
|
20-abx002072 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Rat GNA11 shRNA Plasmid |
|
20-abx986636 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human GNA11 shRNA Plasmid |
|
20-abx951838 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse GNA11 shRNA Plasmid |
|
20-abx970569 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) GNA11 Recombinant Protein (Human) |
|
RP013447 |
ABM |
100 ug |
Ask for price |
GNA11 Recombinant Protein (Human) |
|
RP039505 |
ABM |
100 ug |
Ask for price |
) GNA11 Recombinant Protein (Rat) |
|
RP202928 |
ABM |
100 ug |
Ask for price |
) GNA11 Recombinant Protein (Mouse) |
|
RP138881 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human, Rat), APC) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), APC |
|
4-PAF061Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with APC. |
 Polyclonal Antibody (Human, Rat), Biotinylated) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), Biotinylated |
|
4-PAF061Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human, Rat), Cy3) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), Cy3 |
|
4-PAF061Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human, Rat), FITC) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), FITC |
|
4-PAF061Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human, Rat), HRP) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), HRP |
|
4-PAF061Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human, Rat), PE) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), PE |
|
4-PAF061Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with PE. |
 Polyclonal Antibody (Human, Rat), APC-Cy7) G Protein Alpha 11 (GNa11) Polyclonal Antibody (Human, Rat), APC-Cy7 |
|
4-PAF061Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GNa11 (Met1~Val359)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
|
Description: A Rabbit polyclonal antibody against Human, Rat G Protein Alpha 11 (GNa11). This antibody is labeled with APC-Cy7. |
 Antibody (HRP)) G Protein Alpha 11 (GNA11) Antibody (HRP) |
|
20-abx315269 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) G Protein Alpha 11 (GNA11) Antibody (FITC) |
|
20-abx315270 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) G Protein Alpha 11 (GNA11) Antibody (Biotin) |
|
20-abx315271 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) Gna11 ORF Vector (Rat) (pORF) |
|
ORF067644 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) GNA11 ORF Vector (Human) (pORF) |
|
ORF004483 |
ABM |
1.0 ug DNA |
EUR 95 |
GNA11 ORF Vector (Human) (pORF) |
|
ORF013169 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Gna11 ORF Vector (Mouse) (pORF) |
|
ORF046295 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCD00454)) GNA11 ELISA Kit (Human) (OKCD00454) |
|
OKCD00454 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. Acts as an activator of phospholipase C. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL |
 ELISA kit) Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) ELISA kit |
|
E04G0431-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) ELISA kit |
|
E04G0431-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) ELISA kit |
|
E04G0431-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Guanine nucleotide binding protein subunit Alpha 11(GNA11) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
) Gna11 sgRNA CRISPR Lentivector set (Rat) |
|
K6964901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Gna11 sgRNA CRISPR Lentivector set (Mouse) |
|
K3817801 |
ABM |
3 x 1.0 ug |
EUR 339 |
) GNA11 sgRNA CRISPR Lentivector set (Human) |
|
K0874001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Recombinant G Protein Alpha 11 (GNa11) |
|
4-RPF061Hu01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P29992
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 45.8kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human G Protein Alpha 11 expressed in: E.coli |
 Protein) Human G Protein Alpha 11 (GNa11) Protein |
|
20-abx165861 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 (Target 1)) Gna11 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6964902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Gna11 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6964903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Gna11 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6964904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Gna11 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3817802 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Gna11 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3817803 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Gna11 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3817804 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) GNA11 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0874002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) GNA11 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0874003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) GNA11 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0874004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) GNA11 Protein Vector (Rat) (pPB-C-His) |
|
PV270574 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) GNA11 Protein Vector (Rat) (pPB-N-His) |
|
PV270575 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) GNA11 Protein Vector (Rat) (pPM-C-HA) |
|
PV270576 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) GNA11 Protein Vector (Rat) (pPM-C-His) |
|
PV270577 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) GNA11 Protein Vector (Mouse) (pPB-C-His) |
|
PV185178 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) GNA11 Protein Vector (Mouse) (pPB-N-His) |
|
PV185179 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) GNA11 Protein Vector (Mouse) (pPM-C-HA) |
|
PV185180 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) GNA11 Protein Vector (Mouse) (pPM-C-His) |
|
PV185181 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) GNA11 Protein Vector (Human) (pPB-C-His) |
|
PV017929 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) GNA11 Protein Vector (Human) (pPB-N-His) |
|
PV017930 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) GNA11 Protein Vector (Human) (pPM-C-HA) |
|
PV017931 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) GNA11 Protein Vector (Human) (pPM-C-His) |
|
PV017932 |
ABM |
500 ng |
EUR 329 |
GNA11 Protein Vector (Human) (pPB-C-His) |
|
PV052673 |
ABM |
500 ng |
EUR 481 |
GNA11 Protein Vector (Human) (pPB-N-His) |
|
PV052674 |
ABM |
500 ng |
EUR 481 |
GNA11 Protein Vector (Human) (pPM-C-HA) |
|
PV052675 |
ABM |
500 ng |
EUR 481 |
GNA11 Protein Vector (Human) (pPM-C-His) |
|
PV052676 |
ABM |
500 ng |
EUR 481 |
 Gna11 3'UTR Luciferase Stable Cell Line |
|
TU108841 |
ABM |
1.0 ml |
Ask for price |
Gna11 3'UTR Luciferase Stable Cell Line |
|
TU205200 |
ABM |
1.0 ml |
Ask for price |
 Gna11 3'UTR GFP Stable Cell Line |
|
TU158841 |
ABM |
1.0 ml |
Ask for price |
Gna11 3'UTR GFP Stable Cell Line |
|
TU255200 |
ABM |
1.0 ml |
Ask for price |
 GNA11 3'UTR GFP Stable Cell Line |
|
TU058964 |
ABM |
1.0 ml |
EUR 1394 |
 GNA11 3'UTR Luciferase Stable Cell Line |
|
TU008964 |
ABM |
1.0 ml |
EUR 1394 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
GNA11 Rabbit Polyclonal Antibody
