GNL3 Rabbit Polyclonal Antibody
GNL3 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GNL3 Polyclonal Antibody |
ABP58658-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GNL3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GNL3 from Human, Mouse, Rat. This GNL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNL3 protein |
GNL3 Polyclonal Antibody |
ABP58658-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GNL3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GNL3 from Human, Mouse, Rat. This GNL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNL3 protein |
GNL3 Polyclonal Antibody |
ES9704-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GNL3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNL3 Polyclonal Antibody |
ES9704-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GNL3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GNL3 Rabbit pAb |
A6459-100ul |
Abclonal |
100 ul |
EUR 308 |
GNL3 Rabbit pAb |
A6459-200ul |
Abclonal |
200 ul |
EUR 459 |
GNL3 Rabbit pAb |
A6459-20ul |
Abclonal |
20 ul |
EUR 183 |
GNL3 Rabbit pAb |
A6459-50ul |
Abclonal |
50 ul |
EUR 223 |
GNL3 antibody |
70R-17536 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GNL3 antibody |
GNL3 antibody |
70R-3045 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GNL3 antibody |
GNL3 antibody |
70R-3075 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal GNL3 antibody |
GNL3 Antibody |
36662-100ul |
SAB |
100ul |
EUR 252 |
GNL3 antibody |
38936-100ul |
SAB |
100ul |
EUR 252 |
GNL3 Antibody |
1-CSB-PA874819ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GNL3 Antibody |
1-CSB-PA874819ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GNL3 Antibody |
DF9566 |
Affbiotech |
200ul |
EUR 304 |
Description: GNL3 Antibody detects endogenous levels of total GNL3. |
GNL3 Antibody |
1-CSB-PA184930 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
GNL3 Antibody |
1-CSB-PA206311 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
GNL3 Antibody |
1-CSB-PA009625GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal GNL3 Antibody (N-term) |
APR17767G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal GNL3 Antibody (N-term) |
APR17768G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal GNL3 Antibody (N-term) |
APR17769G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Nucleostemin (GNL3) Antibody (Center) |
AMM06862G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nucleostemin (GNL3) (Center). This antibody is tested and proven to work in the following applications: |
Polyclonal GNL3 Antibody (N-term) |
APR12058G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal (Mouse) Gnl3 Antibody (C-term) |
AMM08711G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Gnl3 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Nucleostemin (GNL3) Antibody (C-term) |
AMM06861G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nucleostemin (GNL3) (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal (Mouse) Gnl3 Antibody (C-term) |
APR11353G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Gnl3 (C-term). This antibody is tested and proven to work in the following applications: |
GNL3 Conjugated Antibody |
C36662 |
SAB |
100ul |
EUR 397 |
GNL3 Conjugated Antibody |
C38936 |
SAB |
100ul |
EUR 397 |
Anti-GNL3 antibody |
STJ28542 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene. |
Anti-GNL3 antibody |
STJ190862 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GNL3 |
GNL3 siRNA |
20-abx902231 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GNL3 siRNA |
20-abx918216 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GNL3 siRNA |
20-abx918217 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Polyclonal Goat Anti-GNL3 Antibody (internal region) |
APR12109G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GNL3 (internal region). This antibody is tested and proven to work in the following applications: |
GNL3 Blocking Peptide |
33R-8008 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNL3 antibody, catalog no. 70R-3075 |
GNL3 Blocking Peptide |
33R-6534 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNL3 antibody, catalog no. 70R-3045 |
GNL3 Blocking Peptide |
DF9566-BP |
Affbiotech |
1mg |
EUR 195 |
GNL3 cloning plasmid |
CSB-CL874819HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1650
- Sequence: atgaaaaggcctaagttaaagaaagcaagtaaacgcatgacctgccataagcggtataaaatccaaaaaaaggttcgagaacatcatcgaaaattaagaaaggaggctaaaaagcagggtcacaagaagcctaggaaagacccaggagttccaaacagtgctccctttaaggagg
- Show more
|
Description: A cloning plasmid for the GNL3 gene. |
Monoclonal GNL3 Antibody, Clone: 2C8D5 |
APR12056G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human GNL3. The antibodies are raised in Mouse and are from clone 2C8D5. This antibody is applicable in WB, FC, E |
Monoclonal GNL3 Antibody, Clone: 2C8D5 |
APR12057G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human GNL3. The antibodies are raised in Mouse and are from clone 2C8D5. This antibody is applicable in WB, E |
Rat GNL3 shRNA Plasmid |
20-abx988442 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GNL3 shRNA Plasmid |
20-abx974036 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GNL3 shRNA Plasmid |
20-abx958821 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GNL3 Recombinant Protein (Human) |
RP013573 |
ABM |
100 ug |
Ask for price |
GNL3 Recombinant Protein (Rat) |
RP203048 |
ABM |
100 ug |
Ask for price |
GNL3 Recombinant Protein (Mouse) |
RP139061 |
ABM |
100 ug |
Ask for price |
Gnl3 ORF Vector (Rat) (pORF) |
ORF067684 |
ABM |
1.0 ug DNA |
EUR 506 |
GNL3 ORF Vector (Human) (pORF) |
ORF004525 |
ABM |
1.0 ug DNA |
EUR 95 |
Gnl3 ORF Vector (Mouse) (pORF) |
ORF046355 |
ABM |
1.0 ug DNA |
EUR 506 |
Gnl3 sgRNA CRISPR Lentivector set (Rat) |
K7282001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gnl3 sgRNA CRISPR Lentivector set (Mouse) |
K3964501 |
ABM |
3 x 1.0 ug |
EUR 339 |
GNL3 sgRNA CRISPR Lentivector set (Human) |
K0878501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx004951 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx015873-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx015874-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx211238 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx211323 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx112902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx031127-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx031127-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx320407 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
20-abx320408 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx432758-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody |
abx432759-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7282002 |
ABM |
1.0 ug DNA |
EUR 154 |
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7282003 |
ABM |
1.0 ug DNA |
EUR 154 |
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7282004 |
ABM |
1.0 ug DNA |
EUR 154 |
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3964502 |
ABM |
1.0 ug DNA |
EUR 154 |
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3964503 |
ABM |
1.0 ug DNA |
EUR 154 |
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3964504 |
ABM |
1.0 ug DNA |
EUR 154 |
GNL3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0878502 |
ABM |
1.0 ug DNA |
EUR 154 |
GNL3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0878503 |
ABM |
1.0 ug DNA |
EUR 154 |
GNL3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0878504 |
ABM |
1.0 ug DNA |
EUR 154 |
GNL3 Protein Vector (Rat) (pPB-C-His) |
PV270734 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Rat) (pPB-N-His) |
PV270735 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Rat) (pPM-C-HA) |
PV270736 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Rat) (pPM-C-His) |
PV270737 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Mouse) (pPB-C-His) |
PV185418 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Mouse) (pPB-N-His) |
PV185419 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Mouse) (pPM-C-HA) |
PV185420 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Mouse) (pPM-C-His) |
PV185421 |
ABM |
500 ng |
EUR 603 |
GNL3 Protein Vector (Human) (pPB-C-His) |
PV018097 |
ABM |
500 ng |
EUR 329 |
GNL3 Protein Vector (Human) (pPB-N-His) |
PV018098 |
ABM |
500 ng |
EUR 329 |
GNL3 Protein Vector (Human) (pPM-C-HA) |
PV018099 |
ABM |
500 ng |
EUR 329 |
GNL3 Protein Vector (Human) (pPM-C-His) |
PV018100 |
ABM |
500 ng |
EUR 329 |
Gnl3 3'UTR Luciferase Stable Cell Line |
TU108879 |
ABM |
1.0 ml |
Ask for price |
Gnl3 3'UTR Luciferase Stable Cell Line |
TU205238 |
ABM |
1.0 ml |
Ask for price |
Gnl3 3'UTR GFP Stable Cell Line |
TU158879 |
ABM |
1.0 ml |
Ask for price |
Gnl3 3'UTR GFP Stable Cell Line |
TU255238 |
ABM |
1.0 ml |
Ask for price |
GNL3 3'UTR GFP Stable Cell Line |
TU059010 |
ABM |
1.0 ml |
EUR 1394 |
GNL3 3'UTR Luciferase Stable Cell Line |
TU009010 |
ABM |
1.0 ml |
EUR 1394 |
GNL3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666355 |
ABM |
1.0 ug DNA |
EUR 682 |
GNL3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666359 |
ABM |
1.0 ug DNA |
EUR 682 |
GNL3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666360 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
GNL3 Rabbit Polyclonal Antibody