GNL3 Rabbit Polyclonal Antibody

GNL3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

GNL3 Polyclonal Antibody
ABP58658-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GNL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNL3 from Human, Mouse, Rat. This GNL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNL3 protein
GNL3 Polyclonal Antibody
ABP58658-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GNL3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GNL3 from Human, Mouse, Rat. This GNL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GNL3 protein
GNL3 Polyclonal Antibody
ES9704-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GNL3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GNL3 Polyclonal Antibody
ES9704-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GNL3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GNL3 Rabbit pAb
A6459-100ul 100 ul
EUR 308
GNL3 Rabbit pAb
A6459-200ul 200 ul
EUR 459
GNL3 Rabbit pAb
A6459-20ul 20 ul
EUR 183
GNL3 Rabbit pAb
A6459-50ul 50 ul
EUR 223
GNL3 antibody
70R-17536 50 ul
EUR 435
Description: Rabbit polyclonal GNL3 antibody
GNL3 antibody
70R-3045 50 ug
EUR 467
Description: Rabbit polyclonal GNL3 antibody
GNL3 antibody
70R-3075 50 ug
EUR 467
Description: Rabbit polyclonal GNL3 antibody
GNL3 Antibody
36662-100ul 100ul
EUR 252
GNL3 antibody
38936-100ul 100ul
EUR 252
GNL3 Antibody
1-CSB-PA874819ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
GNL3 Antibody
1-CSB-PA874819ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
GNL3 Antibody
DF9566 200ul
EUR 304
Description: GNL3 Antibody detects endogenous levels of total GNL3.
GNL3 Antibody
1-CSB-PA184930
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
GNL3 Antibody
1-CSB-PA206311
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
GNL3 Antibody
1-CSB-PA009625GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GNL3. Recognizes GNL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB
GNL3 Antibody
ABD9566 100 ug
EUR 438
Polyclonal GNL3 Antibody (N-term)
APR17767G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal GNL3 Antibody (N-term)
APR17768G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal GNL3 Antibody (N-term)
APR17769G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Nucleostemin (GNL3) Antibody (Center)
AMM06862G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nucleostemin (GNL3) (Center). This antibody is tested and proven to work in the following applications:
Polyclonal GNL3 Antibody (N-term)
APR12058G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNL3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal (Mouse) Gnl3 Antibody (C-term)
AMM08711G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Gnl3 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal Nucleostemin (GNL3) Antibody (C-term)
AMM06861G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nucleostemin (GNL3) (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal (Mouse) Gnl3 Antibody (C-term)
APR11353G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human (Mouse) Gnl3 (C-term). This antibody is tested and proven to work in the following applications:
GNL3 Conjugated Antibody
C36662 100ul
EUR 397
GNL3 Conjugated Antibody
C38936 100ul
EUR 397
Anti-GNL3 antibody
STJ28542 100 µl
EUR 277
Description: The protein encoded by this gene may interact with p53 and may be involved in tumorigenesis. The encoded protein also appears to be important for stem cell proliferation. This protein is found in both the nucleus and nucleolus. Three transcript variants encoding two different isoforms have been found for this gene.
Anti-GNL3 antibody
STJ73439 100 µg
EUR 359
Anti-GNL3 antibody
STJ190862 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GNL3
Gnl3/ Rat Gnl3 ELISA Kit
ELI-09740r 96 Tests
EUR 886
GNL3 siRNA
20-abx902231
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GNL3 siRNA
20-abx918216
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GNL3 siRNA
20-abx918217
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-GNL3
PVT18741 2 ug
EUR 231
Polyclonal Goat Anti-GNL3 Antibody (internal region)
APR12109G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GNL3 (internal region). This antibody is tested and proven to work in the following applications:
GNL3 Blocking Peptide
33R-8008 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNL3 antibody, catalog no. 70R-3075
GNL3 Blocking Peptide
33R-6534 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNL3 antibody, catalog no. 70R-3045
GNL3 Blocking Peptide
DF9566-BP 1mg
EUR 195
GNL3 cloning plasmid
CSB-CL874819HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1650
  • Sequence: atgaaaaggcctaagttaaagaaagcaagtaaacgcatgacctgccataagcggtataaaatccaaaaaaaggttcgagaacatcatcgaaaattaagaaaggaggctaaaaagcagggtcacaagaagcctaggaaagacccaggagttccaaacagtgctccctttaaggagg
  • Show more
Description: A cloning plasmid for the GNL3 gene.
Monoclonal GNL3 Antibody, Clone: 2C8D5
APR12056G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNL3. The antibodies are raised in Mouse and are from clone 2C8D5. This antibody is applicable in WB, FC, E
Monoclonal GNL3 Antibody, Clone: 2C8D5
APR12057G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human GNL3. The antibodies are raised in Mouse and are from clone 2C8D5. This antibody is applicable in WB, E
Anti-GNL3 (aa115-126) antibody
STJ73081 100 µg
EUR 359
Mouse Gnl3 ELISA KIT
ELI-09739m 96 Tests
EUR 865
Human GNL3 ELISA KIT
ELI-08222h 96 Tests
EUR 824
GNL3 ELISA KIT|Human
EF010872 96 Tests
EUR 689
Rat GNL3 shRNA Plasmid
20-abx988442
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GNL3 shRNA Plasmid
20-abx974036
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GNL3 shRNA Plasmid
20-abx958821
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GNL3 Recombinant Protein (Human)
RP013573 100 ug Ask for price
GNL3 Recombinant Protein (Rat)
RP203048 100 ug Ask for price
GNL3 Recombinant Protein (Mouse)
RP139061 100 ug Ask for price
Gnl3 ORF Vector (Rat) (pORF)
ORF067684 1.0 ug DNA
EUR 506
GNL3 ORF Vector (Human) (pORF)
ORF004525 1.0 ug DNA
EUR 95
Gnl3 ORF Vector (Mouse) (pORF)
ORF046355 1.0 ug DNA
EUR 506
pGEX-4T-1-GNL3 Plasmid
PVTB00216-1a 2 ug
EUR 356
pCMV-N-FLAG-GNL3 Plasmid
PVTB00216-2a 2 ug
EUR 356
Gnl3 sgRNA CRISPR Lentivector set (Rat)
K7282001 3 x 1.0 ug
EUR 339
Gnl3 sgRNA CRISPR Lentivector set (Mouse)
K3964501 3 x 1.0 ug
EUR 339
GNL3 sgRNA CRISPR Lentivector set (Human)
K0878501 3 x 1.0 ug
EUR 339
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx004951
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx015873-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx015874-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx211238
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx211323
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx112902
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx031127-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx031127-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx320407
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
20-abx320408
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx432758-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Guanine Nucleotide Binding Protein Like 3 (Nucleolar) (GNL3) Antibody
abx432759-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7282002 1.0 ug DNA
EUR 154
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7282003 1.0 ug DNA
EUR 154
Gnl3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7282004 1.0 ug DNA
EUR 154
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3964502 1.0 ug DNA
EUR 154
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3964503 1.0 ug DNA
EUR 154
Gnl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3964504 1.0 ug DNA
EUR 154
GNL3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0878502 1.0 ug DNA
EUR 154
GNL3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0878503 1.0 ug DNA
EUR 154
GNL3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0878504 1.0 ug DNA
EUR 154
GNL3 Protein Vector (Rat) (pPB-C-His)
PV270734 500 ng
EUR 603
GNL3 Protein Vector (Rat) (pPB-N-His)
PV270735 500 ng
EUR 603
GNL3 Protein Vector (Rat) (pPM-C-HA)
PV270736 500 ng
EUR 603
GNL3 Protein Vector (Rat) (pPM-C-His)
PV270737 500 ng
EUR 603
GNL3 Protein Vector (Mouse) (pPB-C-His)
PV185418 500 ng
EUR 603
GNL3 Protein Vector (Mouse) (pPB-N-His)
PV185419 500 ng
EUR 603
GNL3 Protein Vector (Mouse) (pPM-C-HA)
PV185420 500 ng
EUR 603
GNL3 Protein Vector (Mouse) (pPM-C-His)
PV185421 500 ng
EUR 603
GNL3 Protein Vector (Human) (pPB-C-His)
PV018097 500 ng
EUR 329
GNL3 Protein Vector (Human) (pPB-N-His)
PV018098 500 ng
EUR 329
GNL3 Protein Vector (Human) (pPM-C-HA)
PV018099 500 ng
EUR 329
GNL3 Protein Vector (Human) (pPM-C-His)
PV018100 500 ng
EUR 329
pGL3-Basic-GNL3 promoter(-1500~+100) Plasmid
PVTB00216-2c 2 ug
EUR 356
pGL3-Basic-GNL3 promoter(-900~+140) Plasmid
PVTB00216-2d 2 ug
EUR 356
pGL3-Basic-GNL3 promoter(-600~+140) Plasmid
PVTB00216-2e 2 ug
EUR 356
pGL3-Basic-GNL3 promoter(-360~+140) Plasmid
PVTB00216-2f 2 ug
EUR 356
pGL3-Basic-GNL3 promoter(-360~+100) Plasmid
PVTB00216-2g 2 ug
EUR 356
pGL3-Basic-GNL3 promoter(-210~+100) Plasmid
PVTB00216-2h 2 ug
EUR 356
Gnl3 3'UTR Luciferase Stable Cell Line
TU108879 1.0 ml Ask for price
Gnl3 3'UTR Luciferase Stable Cell Line
TU205238 1.0 ml Ask for price
Gnl3 3'UTR GFP Stable Cell Line
TU158879 1.0 ml Ask for price
Gnl3 3'UTR GFP Stable Cell Line
TU255238 1.0 ml Ask for price
GNL3 3'UTR GFP Stable Cell Line
TU059010 1.0 ml
EUR 1394
GNL3 3'UTR Luciferase Stable Cell Line
TU009010 1.0 ml
EUR 1394
GNL3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV666355 1.0 ug DNA
EUR 682
GNL3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV666359 1.0 ug DNA
EUR 682
GNL3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV666360 1.0 ug DNA
EUR 682
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

GNL3 Rabbit Polyclonal Antibody