GON4L Rabbit Polyclonal Antibody
GON4L Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GON4L Polyclonal Antibody |
ES9679-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GON4L from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GON4L Polyclonal Antibody |
ABP58664-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GON4L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GON4L from Human. This GON4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GON4L protein |
GON4L Polyclonal Antibody |
ABP58664-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GON4L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GON4L from Human. This GON4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GON4L protein |
GON4L Polyclonal Antibody |
ABP58664-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GON4L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GON4L from Human. This GON4L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GON4L protein |
GON4L Antibody |
20-abx215664 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GON4L Antibody |
45991-100ul |
SAB |
100ul |
EUR 252 |
GON4L Antibody |
45991-50ul |
SAB |
50ul |
EUR 187 |
GON4L Antibody |
DF9537 |
Affbiotech |
200ul |
EUR 304 |
Description: GON4L Antibody detects endogenous levels of total GON4L. |
GON4L Conjugated Antibody |
C45991 |
SAB |
100ul |
EUR 397 |
Anti-GON4L antibody |
STJ190837 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GON4L |
GON4L siRNA |
20-abx902241 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GON4L siRNA |
20-abx918285 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GON4L siRNA |
20-abx918286 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GON4L Blocking Peptide |
DF9537-BP |
Affbiotech |
1mg |
EUR 195 |
GON4L cloning plasmid |
CSB-CL668832HU-10ug |
Cusabio |
10ug |
EUR 1790 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4590
- Sequence: ATGTTGCCCTGTAAGAAGAGAAGAACTACAGTGACAGAGTCCCTACAGCATAAAGGCAATCAAGAGGAAAACAACGTAGACCTAGAATCAGCCGTTAAACCAGAATCTGACCAGGTTAAGGACTTGAGTTCGGTGTCACTATCCTGGGATCCAAGTCATGGCAGAGTAGCTGGCT
- Show more
|
Description: A cloning plasmid for the GON4L gene. |
Mouse GON4L shRNA Plasmid |
20-abx978538 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat GON4L shRNA Plasmid |
20-abx990914 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GON4L shRNA Plasmid |
20-abx960269 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Gon4l ORF Vector (Rat) (pORF) |
ORF067708 |
ABM |
1.0 ug DNA |
EUR 2455 |
Gon4l ORF Vector (Mouse) (pORF) |
ORF046389 |
ABM |
1.0 ug DNA |
EUR 2440 |
Gon4l ORF Vector (Mouse) (pORF) |
ORF046390 |
ABM |
1.0 ug DNA |
EUR 2458 |
GON4L ORF Vector (Human) (pORF) |
ORF013176 |
ABM |
1.0 ug DNA |
EUR 354 |
GON4L sgRNA CRISPR Lentivector set (Human) |
K0883401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gon4l sgRNA CRISPR Lentivector set (Mouse) |
K4575501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gon4l sgRNA CRISPR Lentivector set (Rat) |
K6640101 |
ABM |
3 x 1.0 ug |
EUR 339 |
GON4L sgRNA CRISPR Lentivector (Human) (Target 1) |
K0883402 |
ABM |
1.0 ug DNA |
EUR 154 |
GON4L sgRNA CRISPR Lentivector (Human) (Target 2) |
K0883403 |
ABM |
1.0 ug DNA |
EUR 154 |
GON4L sgRNA CRISPR Lentivector (Human) (Target 3) |
K0883404 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4575502 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4575503 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4575504 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6640102 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6640103 |
ABM |
1.0 ug DNA |
EUR 154 |
Gon4l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6640104 |
ABM |
1.0 ug DNA |
EUR 154 |
GON4L Protein Vector (Human) (pPB-C-His) |
PV052701 |
ABM |
500 ng |
EUR 481 |
GON4L Protein Vector (Human) (pPB-N-His) |
PV052702 |
ABM |
500 ng |
EUR 481 |
GON4L Protein Vector (Human) (pPM-C-HA) |
PV052703 |
ABM |
500 ng |
EUR 481 |
GON4L Protein Vector (Human) (pPM-C-His) |
PV052704 |
ABM |
500 ng |
EUR 481 |
GON4L Protein Vector (Mouse) (pPB-C-His) |
PV185554 |
ABM |
500 ng |
EUR 3667 |
GON4L Protein Vector (Mouse) (pPB-N-His) |
PV185555 |
ABM |
500 ng |
EUR 3667 |
GON4L Protein Vector (Mouse) (pPM-C-HA) |
PV185556 |
ABM |
500 ng |
EUR 3667 |
GON4L Protein Vector (Mouse) (pPM-C-His) |
PV185557 |
ABM |
500 ng |
EUR 3667 |
GON4L Protein Vector (Mouse) (pPB-C-His) |
PV185558 |
ABM |
500 ng |
EUR 3693 |
GON4L Protein Vector (Mouse) (pPB-N-His) |
PV185559 |
ABM |
500 ng |
EUR 3693 |
GON4L Protein Vector (Mouse) (pPM-C-HA) |
PV185560 |
ABM |
500 ng |
EUR 3693 |
GON4L Protein Vector (Mouse) (pPM-C-His) |
PV185561 |
ABM |
500 ng |
EUR 3693 |
GON4L Protein Vector (Rat) (pPB-C-His) |
PV270830 |
ABM |
500 ng |
EUR 3689 |
GON4L Protein Vector (Rat) (pPB-N-His) |
PV270831 |
ABM |
500 ng |
EUR 3689 |
GON4L Protein Vector (Rat) (pPM-C-HA) |
PV270832 |
ABM |
500 ng |
EUR 3689 |
GON4L Protein Vector (Rat) (pPM-C-His) |
PV270833 |
ABM |
500 ng |
EUR 3689 |
Gon4l 3'UTR Luciferase Stable Cell Line |
TU205265 |
ABM |
1.0 ml |
Ask for price |
Gon4l 3'UTR GFP Stable Cell Line |
TU158905 |
ABM |
1.0 ml |
Ask for price |
GON4L 3'UTR Luciferase Stable Cell Line |
TU009078 |
ABM |
1.0 ml |
EUR 1394 |
Gon4l 3'UTR Luciferase Stable Cell Line |
TU108905 |
ABM |
1.0 ml |
Ask for price |
GON4L 3'UTR GFP Stable Cell Line |
TU059078 |
ABM |
1.0 ml |
EUR 1394 |
Gon4l 3'UTR GFP Stable Cell Line |
TU255265 |
ABM |
1.0 ml |
Ask for price |
Mouse GON- 4- like protein, Gon4l ELISA KIT |
ELI-08199m |
Lifescience Market |
96 Tests |
EUR 865 |
Human GON- 4- like protein, GON4L ELISA KIT |
ELI-43486h |
Lifescience Market |
96 Tests |
EUR 824 |
GON4L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV664363 |
ABM |
1.0 ug DNA |
EUR 3423 |
GON4L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV664367 |
ABM |
1.0 ug DNA |
EUR 3423 |
GON4L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV664368 |
ABM |
1.0 ug DNA |
EUR 3423 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
GON4L Rabbit Polyclonal Antibody