GPSM3 Rabbit Polyclonal Antibody

GPSM3 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

GPSM3 Polyclonal Antibody
ES9682-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPSM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
GPSM3 Polyclonal Antibody
ABP58703-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein
GPSM3 Polyclonal Antibody
ABP58703-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein
GPSM3 Polyclonal Antibody
ABP58703-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
  • Applications tips:
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein
GPSM3 Polyclonal Antibody
A68158 100 µg
EUR 570.55
Description: The best epigenetics products
GPSM3 Antibody
ABD9541 100 ug
EUR 438
GPSM3 Antibody
45995-100ul 100ul
EUR 252
GPSM3 Antibody
45995-50ul 50ul
EUR 187
GPSM3 Antibody
DF9541 200ul
EUR 304
Description: GPSM3 Antibody detects endogenous levels of total GPSM3.
GPSM3 Antibody
1-CSB-PA896517LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
GPSM3 Polyclonal Antibody, HRP Conjugated
A68159 100 µg
EUR 570.55
Description: kits suitable for this type of research
GPSM3 Polyclonal Antibody, FITC Conjugated
A68160 100 µg
EUR 570.55
Description: fast delivery possible
GPSM3 Polyclonal Antibody, Biotin Conjugated
A68161 100 µg
EUR 570.55
Description: reagents widely cited
Gpsm3/ Rat Gpsm3 ELISA Kit
ELI-19464r 96 Tests
EUR 886
GPSM3 Conjugated Antibody
C45995 100ul
EUR 397
GPSM3 Antibody (HRP)
20-abx312361
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPSM3 Antibody (FITC)
20-abx312362
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPSM3 Antibody (Biotin)
20-abx312363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-GPSM3 antibody
STJ190840 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to GPSM3
GPSM3 siRNA
20-abx902295
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPSM3 siRNA
20-abx918600
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPSM3 siRNA
20-abx918601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPSM3 Antibody, HRP conjugated
1-CSB-PA896517LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
GPSM3 Antibody, FITC conjugated
1-CSB-PA896517LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
GPSM3 Antibody, Biotin conjugated
1-CSB-PA896517LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
GPSM3 Blocking Peptide
DF9541-BP 1mg
EUR 195
GPSM3 cloning plasmid
CSB-CL896517HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atggaggctgagagaccccaggaagaagaggatggtgagcagggcccccctcaggatgaggaaggctggccccctccaaactccaccactcggccttggcgatctgctcctccatcccctcctcctccagggacccgccacacagccctgggaccccgctcggcctccctgctctc
  • Show more
Description: A cloning plasmid for the GPSM3 gene.
Anti-GPSM3 (1F11)
YF-MA19180 100 ug
EUR 363
Description: Mouse monoclonal to GPSM3
Mouse GPSM3 shRNA Plasmid
20-abx979745
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat GPSM3 shRNA Plasmid
20-abx990724
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPSM3 shRNA Plasmid
20-abx961874
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
GPSM3 Recombinant Protein (Human)
RP013948 100 ug Ask for price
GPSM3 Recombinant Protein (Rat)
RP203519 100 ug Ask for price
GPSM3 Recombinant Protein (Mouse)
RP139820 100 ug Ask for price
G-Protein-Signaling Modulator 3 (GPSM3) Antibody
20-abx148057
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
G-Protein-Signaling Modulator 3 (GPSM3) Antibody
20-abx301757
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
GPSM3 ORF Vector (Human) (pORF)
ORF004650 1.0 ug DNA
EUR 95
Gpsm3 ORF Vector (Rat) (pORF)
ORF067841 1.0 ug DNA
EUR 506
h GPSM3 inducible lentiviral particles
LVP112 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, GPSM3, is fully sequence verified and matched to NCBI accession ID: NM_022107.1
Gpsm3 ORF Vector (Mouse) (pORF)
ORF046608 1.0 ug DNA
EUR 506
GPSM3 sgRNA CRISPR Lentivector set (Human)
K0901901 3 x 1.0 ug
EUR 339
Gpsm3 sgRNA CRISPR Lentivector set (Rat)
K7571001 3 x 1.0 ug
EUR 339
Gpsm3 sgRNA CRISPR Lentivector set (Mouse)
K4842501 3 x 1.0 ug
EUR 339
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0901902 1.0 ug DNA
EUR 154
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0901903 1.0 ug DNA
EUR 154
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0901904 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7571002 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7571003 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7571004 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4842502 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4842503 1.0 ug DNA
EUR 154
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4842504 1.0 ug DNA
EUR 154
GPSM3 Protein Vector (Rat) (pPB-C-His)
PV271362 500 ng
EUR 603
GPSM3 Protein Vector (Rat) (pPB-N-His)
PV271363 500 ng
EUR 603
GPSM3 Protein Vector (Rat) (pPM-C-HA)
PV271364 500 ng
EUR 603
GPSM3 Protein Vector (Rat) (pPM-C-His)
PV271365 500 ng
EUR 603
GPSM3 Protein Vector (Human) (pPB-C-His)
PV018597 500 ng
EUR 329
GPSM3 Protein Vector (Human) (pPB-N-His)
PV018598 500 ng
EUR 329
GPSM3 Protein Vector (Human) (pPM-C-HA)
PV018599 500 ng
EUR 329
GPSM3 Protein Vector (Human) (pPM-C-His)
PV018600 500 ng
EUR 329
GPSM3 Protein Vector (Mouse) (pPB-C-His)
PV186430 500 ng
EUR 603
GPSM3 Protein Vector (Mouse) (pPB-N-His)
PV186431 500 ng
EUR 603
GPSM3 Protein Vector (Mouse) (pPM-C-HA)
PV186432 500 ng
EUR 603
GPSM3 Protein Vector (Mouse) (pPM-C-His)
PV186433 500 ng
EUR 603
Gpsm3 3'UTR Luciferase Stable Cell Line
TU205414 1.0 ml Ask for price
Gpsm3 3'UTR GFP Stable Cell Line
TU159066 1.0 ml Ask for price
GPSM3 3'UTR Luciferase Stable Cell Line
TU009269 1.0 ml
EUR 1394
Gpsm3 3'UTR Luciferase Stable Cell Line
TU109066 1.0 ml Ask for price
GPSM3 3'UTR GFP Stable Cell Line
TU059269 1.0 ml
EUR 1394
Gpsm3 3'UTR GFP Stable Cell Line
TU255414 1.0 ml Ask for price
GPSM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV661423 1.0 ug DNA
EUR 514
GPSM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV661427 1.0 ug DNA
EUR 514
GPSM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV661428 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GPSM3 Rabbit Polyclonal Antibody