GPSM3 Rabbit Polyclonal Antibody
GPSM3 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
GPSM3 Polyclonal Antibody |
ES9682-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GPSM3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
GPSM3 Polyclonal Antibody |
ABP58703-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein |
GPSM3 Polyclonal Antibody |
ABP58703-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein |
GPSM3 Polyclonal Antibody |
ABP58703-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GPSM3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of GPSM3 from Human, Mouse, Rat. This GPSM3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPSM3 protein |
GPSM3 Polyclonal Antibody |
A68158 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
GPSM3 Antibody |
45995-100ul |
SAB |
100ul |
EUR 252 |
GPSM3 Antibody |
45995-50ul |
SAB |
50ul |
EUR 187 |
GPSM3 Antibody |
DF9541 |
Affbiotech |
200ul |
EUR 304 |
Description: GPSM3 Antibody detects endogenous levels of total GPSM3. |
GPSM3 Antibody |
1-CSB-PA896517LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
GPSM3 Polyclonal Antibody, HRP Conjugated |
A68159 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
GPSM3 Polyclonal Antibody, FITC Conjugated |
A68160 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GPSM3 Polyclonal Antibody, Biotin Conjugated |
A68161 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GPSM3 Conjugated Antibody |
C45995 |
SAB |
100ul |
EUR 397 |
GPSM3 Antibody (HRP) |
20-abx312361 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GPSM3 Antibody (FITC) |
20-abx312362 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GPSM3 Antibody (Biotin) |
20-abx312363 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Anti-GPSM3 antibody |
STJ190840 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to GPSM3 |
GPSM3 siRNA |
20-abx902295 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPSM3 siRNA |
20-abx918600 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPSM3 siRNA |
20-abx918601 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GPSM3 Antibody, HRP conjugated |
1-CSB-PA896517LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GPSM3 Antibody, FITC conjugated |
1-CSB-PA896517LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GPSM3 Antibody, Biotin conjugated |
1-CSB-PA896517LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GPSM3. Recognizes GPSM3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GPSM3 Blocking Peptide |
DF9541-BP |
Affbiotech |
1mg |
EUR 195 |
GPSM3 cloning plasmid |
CSB-CL896517HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 483
- Sequence: atggaggctgagagaccccaggaagaagaggatggtgagcagggcccccctcaggatgaggaaggctggccccctccaaactccaccactcggccttggcgatctgctcctccatcccctcctcctccagggacccgccacacagccctgggaccccgctcggcctccctgctctc
- Show more
|
Description: A cloning plasmid for the GPSM3 gene. |
Anti-GPSM3 (1F11) |
YF-MA19180 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to GPSM3 |
Mouse GPSM3 shRNA Plasmid |
20-abx979745 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat GPSM3 shRNA Plasmid |
20-abx990724 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GPSM3 shRNA Plasmid |
20-abx961874 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
GPSM3 Recombinant Protein (Human) |
RP013948 |
ABM |
100 ug |
Ask for price |
GPSM3 Recombinant Protein (Rat) |
RP203519 |
ABM |
100 ug |
Ask for price |
GPSM3 Recombinant Protein (Mouse) |
RP139820 |
ABM |
100 ug |
Ask for price |
G-Protein-Signaling Modulator 3 (GPSM3) Antibody |
20-abx148057 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
G-Protein-Signaling Modulator 3 (GPSM3) Antibody |
20-abx301757 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
GPSM3 ORF Vector (Human) (pORF) |
ORF004650 |
ABM |
1.0 ug DNA |
EUR 95 |
Gpsm3 ORF Vector (Rat) (pORF) |
ORF067841 |
ABM |
1.0 ug DNA |
EUR 506 |
h GPSM3 inducible lentiviral particles |
LVP112 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, GPSM3, is fully sequence verified and matched to NCBI accession ID: NM_022107.1 |
Gpsm3 ORF Vector (Mouse) (pORF) |
ORF046608 |
ABM |
1.0 ug DNA |
EUR 506 |
GPSM3 sgRNA CRISPR Lentivector set (Human) |
K0901901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gpsm3 sgRNA CRISPR Lentivector set (Rat) |
K7571001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Gpsm3 sgRNA CRISPR Lentivector set (Mouse) |
K4842501 |
ABM |
3 x 1.0 ug |
EUR 339 |
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0901902 |
ABM |
1.0 ug DNA |
EUR 154 |
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0901903 |
ABM |
1.0 ug DNA |
EUR 154 |
GPSM3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0901904 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7571002 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7571003 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7571004 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4842502 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4842503 |
ABM |
1.0 ug DNA |
EUR 154 |
Gpsm3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4842504 |
ABM |
1.0 ug DNA |
EUR 154 |
GPSM3 Protein Vector (Rat) (pPB-C-His) |
PV271362 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Rat) (pPB-N-His) |
PV271363 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Rat) (pPM-C-HA) |
PV271364 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Rat) (pPM-C-His) |
PV271365 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Human) (pPB-C-His) |
PV018597 |
ABM |
500 ng |
EUR 329 |
GPSM3 Protein Vector (Human) (pPB-N-His) |
PV018598 |
ABM |
500 ng |
EUR 329 |
GPSM3 Protein Vector (Human) (pPM-C-HA) |
PV018599 |
ABM |
500 ng |
EUR 329 |
GPSM3 Protein Vector (Human) (pPM-C-His) |
PV018600 |
ABM |
500 ng |
EUR 329 |
GPSM3 Protein Vector (Mouse) (pPB-C-His) |
PV186430 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Mouse) (pPB-N-His) |
PV186431 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Mouse) (pPM-C-HA) |
PV186432 |
ABM |
500 ng |
EUR 603 |
GPSM3 Protein Vector (Mouse) (pPM-C-His) |
PV186433 |
ABM |
500 ng |
EUR 603 |
Gpsm3 3'UTR Luciferase Stable Cell Line |
TU205414 |
ABM |
1.0 ml |
Ask for price |
Gpsm3 3'UTR GFP Stable Cell Line |
TU159066 |
ABM |
1.0 ml |
Ask for price |
GPSM3 3'UTR Luciferase Stable Cell Line |
TU009269 |
ABM |
1.0 ml |
EUR 1394 |
Gpsm3 3'UTR Luciferase Stable Cell Line |
TU109066 |
ABM |
1.0 ml |
Ask for price |
GPSM3 3'UTR GFP Stable Cell Line |
TU059269 |
ABM |
1.0 ml |
EUR 1394 |
Gpsm3 3'UTR GFP Stable Cell Line |
TU255414 |
ABM |
1.0 ml |
Ask for price |
GPSM3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV661423 |
ABM |
1.0 ug DNA |
EUR 514 |
GPSM3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV661427 |
ABM |
1.0 ug DNA |
EUR 514 |
GPSM3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV661428 |
ABM |
1.0 ug DNA |
EUR 514 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
GPSM3 Rabbit Polyclonal Antibody