MAL Rabbit Polyclonal Antibody
MAL Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
MAL Polyclonal Antibody |
ABP59210-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of MAL from Human, Mouse, Rat. This MAL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150 |
MAL Antibody |
37714-100ul |
SAB |
100ul |
EUR 252 |
MAL Antibody |
DF9645 |
Affbiotech |
200ul |
EUR 304 |
Description: MAL Antibody detects endogenous levels of total MAL. |
MAL Antibody |
1-CSB-PA913398 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MAL. Recognizes MAL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
MAL Antibody |
1-CSB-PA013372LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Mal-PEG-Mal |
abx085029-06kDa1g |
Abbexa |
0.6 kDa; 1 g |
EUR 481 |
- Shipped within 5-10 working days.
|
Mal-PEG-Mal |
abx085029-08kDa1g |
Abbexa |
0.8 kDa; 1 g |
EUR 509 |
- Shipped within 5-10 working days.
|
Mal-PEG-Mal |
abx085029-1kDa1g |
Abbexa |
1 kDa; 1 g |
EUR 537 |
- Shipped within 5-10 working days.
|
Mal-PEG-Mal |
abx085029-2kDa5g |
Abbexa |
2 kDa; 5 g |
EUR 565 |
- Shipped within 5-10 working days.
|
Mal-PEG-Mal |
abx085029-34kDa5g |
Abbexa |
3.4 kDa; 5 g |
EUR 565 |
- Shipped within 5-10 working days.
|
MAL-PEG-MAL,10K |
33-HO022022-10K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,1K |
33-HO022022-1K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,20K |
33-HO022022-20K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,2K |
33-HO022022-2K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,3.4K |
33-HO022022-3.4K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,5K |
33-HO022022-5K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,600 |
33-HO022022-600 |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,6K |
33-HO022022-6K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-MAL,800 |
33-HO022022-800 |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL Conjugated Antibody |
C37714 |
SAB |
100ul |
EUR 397 |
Anti-MAL antibody |
STJ190993 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MAL |
Polyclonal Goat Anti-TIRAP / Mal (Isoform b) Antibody |
APG00333G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIRAP / Mal (Isoform b) . This antibody is tested and proven to work in the following applications: |
Mal (Isoform b) Antibody |
abx430620-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
MAL Antibody, HRP conjugated |
1-CSB-PA013372LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MAL Antibody, FITC conjugated |
1-CSB-PA013372LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MAL Antibody, Biotin conjugated |
1-CSB-PA013372LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MAL siRNA |
20-abx903119 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
mPEG-Mal |
abx085012-035kDa1g |
Abbexa |
0.35 kDa; 1 g |
EUR 425 |
- Shipped within 5-10 working days.
|
mPEG-Mal |
abx085012-075kDa1g |
Abbexa |
0.75 kDa; 1 g |
EUR 467 |
- Shipped within 5-10 working days.
|
mPEG-Mal |
abx085012-30kDa1g |
Abbexa |
30 kDa; 1 g |
EUR 453 |
- Shipped within 5-10 working days.
|
mPEG-Mal |
abx085012-40kDa1g |
Abbexa |
40 kDa; 1 g |
EUR 453 |
- Shipped within 5-10 working days.
|
MAL siRNA |
20-abx923351 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MAL siRNA |
20-abx923352 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MAL |
YF-PA13045 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MAL |
MAL cloning plasmid |
CSB-CL013372HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 462
- Sequence: atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtc
- Show more
|
Description: A cloning plasmid for the MAL gene. |
Mal-PEG-OH |
33-HE022002-1K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-NH2,10K |
33-HE022005-10K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-NH2,1K |
33-HE022005-1K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-NH2,20K |
33-HE022005-20K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL-PEG-NH2,2K |
33-HE022005-2K |
Biochempeg |
|
|
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound. |
MAL Rabbit Polyclonal Antibody