MAL Rabbit Polyclonal Antibody

MAL Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MAL Polyclonal Antibody

ABP59210-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150
  • Applications tips:
Description: A polyclonal antibody for detection of MAL from Human, Mouse, Rat. This MAL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MAL protein at amino acid sequence of 70-150

MAL Antibody

ABD9645 100 ug
EUR 438

MAL Antibody

37714-100ul 100ul
EUR 252

MAL Antibody

DF9645 200ul
EUR 304
Description: MAL Antibody detects endogenous levels of total MAL.

MAL Antibody

1-CSB-PA913398
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAL. Recognizes MAL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

MAL Antibody

1-CSB-PA013372LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Mal-PEG-Mal

abx085029-06kDa1g 0.6 kDa; 1 g
EUR 481
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-08kDa1g 0.8 kDa; 1 g
EUR 509
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-1kDa1g 1 kDa; 1 g
EUR 537
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-2kDa5g 2 kDa; 5 g
EUR 565
  • Shipped within 5-10 working days.

Mal-PEG-Mal

abx085029-34kDa5g 3.4 kDa; 5 g
EUR 565
  • Shipped within 5-10 working days.

MAL-PEG-MAL,10K

33-HO022022-10K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,1K

33-HO022022-1K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,20K

33-HO022022-20K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,2K

33-HO022022-2K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,3.4K

33-HO022022-3.4K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,5K

33-HO022022-5K
  • EUR 201.00
  • EUR 468.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,600

33-HO022022-600
  • EUR 283.00
  • EUR 747.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,6K

33-HO022022-6K
  • EUR 236.00
  • EUR 607.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-MAL,800

33-HO022022-800
  • EUR 259.00
  • EUR 677.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL Conjugated Antibody

C37714 100ul
EUR 397

Anti-MAL antibody

STJ190993 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MAL

Mal/ Rat Mal ELISA Kit

ELI-06313r 96 Tests
EUR 886

Polyclonal Goat Anti-TIRAP / Mal (Isoform b) Antibody

APG00333G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TIRAP / Mal (Isoform b) . This antibody is tested and proven to work in the following applications:

Mal (Isoform b) Antibody

abx430620-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

MAL Antibody, HRP conjugated

1-CSB-PA013372LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAL Antibody, FITC conjugated

1-CSB-PA013372LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAL Antibody, Biotin conjugated

1-CSB-PA013372LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAL. Recognizes MAL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MAL siRNA

20-abx903119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-035kDa1g 0.35 kDa; 1 g
EUR 425
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-075kDa1g 0.75 kDa; 1 g
EUR 467
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-30kDa1g 30 kDa; 1 g
EUR 453
  • Shipped within 5-10 working days.

mPEG-Mal

abx085012-40kDa1g 40 kDa; 1 g
EUR 453
  • Shipped within 5-10 working days.

MAL siRNA

20-abx923351
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAL siRNA

20-abx923352
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-MAL

PVT18304 2 ug
EUR 231

anti-MAL

YF-PA13045 50 ug
EUR 363
Description: Mouse polyclonal to MAL

MAL-HA-Osu

ADC-L-021 unit Ask for price

Mal-PEG4-NHS

ADC-L-078 unit Ask for price

Mal-PEG-NHS

ADC-L-080 unit Ask for price

Mal-PEG10-NHS

ADC-L-083 unit Ask for price

Mal-PEG5-NHS

ADC-L-145 unit Ask for price

Mal-PEG10-NHS

ADC-L-148 unit Ask for price

MAL cloning plasmid

CSB-CL013372HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atggcccccgcagcggcgacggggggcagcaccctgcccagtggcttctcggtcttcaccaccttgcccgacttgctcttcatctttgagtttatcttcgggggcctggtgtggatcctggtggcctcctccctggtgccctggcccctggtccagggctgggtgatgttcgtgtc
  • Show more
Description: A cloning plasmid for the MAL gene.

Mal-PEG-OH

33-HE022002-1K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,10K

33-HE022005-10K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,1K

33-HE022005-1K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,20K

33-HE022005-20K
  • EUR 445.00
  • EUR 1234.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL-PEG-NH2,2K

33-HE022005-2K
  • EUR 420.00
  • EUR 1160.00
  • 1g
  • 5g
Description: A high purity chemical with various applications in medical research, drug-release, nanotechnology and new materials research, cell culture. In the study of ligand, polypeptide synthesis support, a graft polymer compounds, new materials, and polyethylene glycol-modified functional coatings and other aspects of the active compound.

MAL Rabbit Polyclonal Antibody