MCF2L Rabbit Polyclonal Antibody

MCF2L Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MCF2L Polyclonal Antibody
ES9696-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MCF2L from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MCF2L Polyclonal Antibody
ABP59237-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein
MCF2L Polyclonal Antibody
ABP59237-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein
MCF2L Polyclonal Antibody
ABP59237-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
  • Applications tips:
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein
MCF2L Rabbit pAb
A9966-100ul 100 ul
EUR 308
MCF2L Rabbit pAb
A9966-200ul 200 ul
EUR 459
MCF2L Rabbit pAb
A9966-20ul 20 ul
EUR 183
MCF2L Rabbit pAb
A9966-50ul 50 ul
EUR 223
MCF2L Antibody
ABD2202 100 ug
EUR 438
MCF2L Antibody
44664-100ul 100ul
EUR 252
MCF2L Antibody
44664-50ul 50ul
EUR 187
MCF2L Antibody
DF2202 200ul
EUR 304
Description: MCF2L antibody detects endogenous levels of total MCF2L.
MCF2L Antibody
1-CSB-PA521145ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MCF2L. Recognizes MCF2L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Polyclonal MCF2L Antibody (internal region)
APR17333G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MCF2L (internal region). This antibody is tested and proven to work in the following applications:
Mcf2l/ Rat Mcf2l ELISA Kit
ELI-39671r 96 Tests
EUR 886
MCF2L Conjugated Antibody
C44664 100ul
EUR 397
Anti-MCF2L antibody
STJ72334 100 µg
EUR 359
Anti-MCF2L antibody
STJ112007 100 µl
EUR 277
Description: This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants.
Anti-MCF2L antibody
STJ190854 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MCF2L
MCF2L siRNA
20-abx923716
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MCF2L siRNA
20-abx923717
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
MCF2L cloning plasmid
CSB-CL521145HU-10ug 10ug
EUR 937
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2955
  • Sequence: atgacggtgcgccggctgtcactgctgtgccgggacctctgggcgctgtggctgctgctgaaggccggcgcagatgaaatcatgcaccaggacatcgtcccgctctgtgctgccgacatccaggaccagctaaagaagcgctttgcttacctgtccggtgggcgggggcaggacg
  • Show more
Description: A cloning plasmid for the MCF2L gene.
MCF2L Blocking Peptide
DF2202-BP 1mg
EUR 195
Rat MCF2L shRNA Plasmid
20-abx987371
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
MCF2L ELISA KIT|Human
EF005250 96 Tests
EUR 689
Human MCF2L shRNA Plasmid
20-abx958134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Monoclonal MCF2L Antibody (monoclonal) (M01), Clone: 1D11
APR17334G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human MCF2L (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IHC, E
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
abx145500-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
20-abx148325
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
20-abx135886
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
abx030565-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
abx030565-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
20-abx321151
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody
abx431423-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
MCF2L ORF Vector (Human) (pORF)
ORF006323 1.0 ug DNA
EUR 95
Mcf2l ORF Vector (Mouse) (pORF)
ORF049934 1.0 ug DNA
EUR 506
Mcf2l ORF Vector (Mouse) (pORF)
ORF049935 1.0 ug DNA
EUR 506
Mcf2l ORF Vector (Mouse) (pORF)
ORF049936 1.0 ug DNA
EUR 506
Mcf2l ORF Vector (Rat) (pORF)
ORF070369 1.0 ug DNA
EUR 506
MCF2L sgRNA CRISPR Lentivector set (Human)
K1279201 3 x 1.0 ug
EUR 339
Mcf2l sgRNA CRISPR Lentivector set (Mouse)
K5000801 3 x 1.0 ug
EUR 339
Mcf2l sgRNA CRISPR Lentivector set (Rat)
K7057001 3 x 1.0 ug
EUR 339
MCF2L-AS1 ORF Vector (Human) (pORF)
ORF023387 1.0 ug DNA Ask for price
MCF2L sgRNA CRISPR Lentivector (Human) (Target 1)
K1279202 1.0 ug DNA
EUR 154
MCF2L sgRNA CRISPR Lentivector (Human) (Target 2)
K1279203 1.0 ug DNA
EUR 154
MCF2L sgRNA CRISPR Lentivector (Human) (Target 3)
K1279204 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5000802 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5000803 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5000804 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 1)
K7057002 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 2)
K7057003 1.0 ug DNA
EUR 154
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 3)
K7057004 1.0 ug DNA
EUR 154
MCF2L Protein Vector (Rat) (pPB-C-His)
PV281474 500 ng
EUR 1191
MCF2L Protein Vector (Rat) (pPB-N-His)
PV281475 500 ng
EUR 1191
MCF2L Protein Vector (Rat) (pPM-C-HA)
PV281476 500 ng
EUR 1191
MCF2L Protein Vector (Rat) (pPM-C-His)
PV281477 500 ng
EUR 1191
MCF2L Protein Vector (Human) (pPB-C-His)
PV025289 500 ng
EUR 329
MCF2L Protein Vector (Human) (pPB-N-His)
PV025290 500 ng
EUR 329
MCF2L Protein Vector (Human) (pPM-C-HA)
PV025291 500 ng
EUR 329
MCF2L Protein Vector (Human) (pPM-C-His)
PV025292 500 ng
EUR 329
MCF2L Protein Vector (Mouse) (pPB-C-His)
PV199734 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPB-N-His)
PV199735 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-HA)
PV199736 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-His)
PV199737 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPB-C-His)
PV199738 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPB-N-His)
PV199739 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-HA)
PV199740 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-His)
PV199741 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPB-C-His)
PV199742 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPB-N-His)
PV199743 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-HA)
PV199744 500 ng
EUR 1065
MCF2L Protein Vector (Mouse) (pPM-C-His)
PV199745 500 ng
EUR 1065
Mcf2l 3'UTR Luciferase Stable Cell Line
TU212956 1.0 ml Ask for price
MCF2L 3'UTR Luciferase Stable Cell Line
TU013112 1.0 ml
EUR 2333
MCF2L 3'UTR GFP Stable Cell Line
TU063112 1.0 ml
EUR 2333
Mcf2l 3'UTR GFP Stable Cell Line
TU262956 1.0 ml Ask for price
MCF2L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV667747 1.0 ug DNA
EUR 1355
MCF2L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV667751 1.0 ug DNA
EUR 1355
MCF2L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV667752 1.0 ug DNA
EUR 1355
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

MCF2L Rabbit Polyclonal Antibody