MCF2L Rabbit Polyclonal Antibody
MCF2L Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
MCF2L Polyclonal Antibody |
ES9696-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MCF2L from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MCF2L Polyclonal Antibody |
ABP59237-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein |
MCF2L Polyclonal Antibody |
ABP59237-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein |
MCF2L Polyclonal Antibody |
ABP59237-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MCF2L protein
- Applications tips:
|
Description: A polyclonal antibody for detection of MCF2L from Human. This MCF2L antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MCF2L protein |
MCF2L Rabbit pAb |
A9966-100ul |
Abclonal |
100 ul |
EUR 308 |
MCF2L Rabbit pAb |
A9966-200ul |
Abclonal |
200 ul |
EUR 459 |
MCF2L Rabbit pAb |
A9966-20ul |
Abclonal |
20 ul |
EUR 183 |
MCF2L Rabbit pAb |
A9966-50ul |
Abclonal |
50 ul |
EUR 223 |
MCF2L Antibody |
44664-100ul |
SAB |
100ul |
EUR 252 |
MCF2L Antibody |
44664-50ul |
SAB |
50ul |
EUR 187 |
MCF2L Antibody |
DF2202 |
Affbiotech |
200ul |
EUR 304 |
Description: MCF2L antibody detects endogenous levels of total MCF2L. |
MCF2L Antibody |
1-CSB-PA521145ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MCF2L. Recognizes MCF2L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal MCF2L Antibody (internal region) |
APR17333G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MCF2L (internal region). This antibody is tested and proven to work in the following applications: |
MCF2L Conjugated Antibody |
C44664 |
SAB |
100ul |
EUR 397 |
Anti-MCF2L antibody |
STJ112007 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. |
Anti-MCF2L antibody |
STJ190854 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MCF2L |
MCF2L siRNA |
20-abx923716 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCF2L siRNA |
20-abx923717 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MCF2L cloning plasmid |
CSB-CL521145HU-10ug |
Cusabio |
10ug |
EUR 937 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2955
- Sequence: atgacggtgcgccggctgtcactgctgtgccgggacctctgggcgctgtggctgctgctgaaggccggcgcagatgaaatcatgcaccaggacatcgtcccgctctgtgctgccgacatccaggaccagctaaagaagcgctttgcttacctgtccggtgggcgggggcaggacg
- Show more
|
Description: A cloning plasmid for the MCF2L gene. |
MCF2L Blocking Peptide |
DF2202-BP |
Affbiotech |
1mg |
EUR 195 |
Rat MCF2L shRNA Plasmid |
20-abx987371 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MCF2L shRNA Plasmid |
20-abx958134 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal MCF2L Antibody (monoclonal) (M01), Clone: 1D11 |
APR17334G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human MCF2L (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D11. This antibody is applicable in WB and IHC, E |
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
abx145500-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
20-abx148325 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
20-abx135886 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
abx030565-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
abx030565-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
20-abx321151 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Guanine Nucleotide Exchange Factor DBS (MCF2L) Antibody |
abx431423-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
MCF2L ORF Vector (Human) (pORF) |
ORF006323 |
ABM |
1.0 ug DNA |
EUR 95 |
Mcf2l ORF Vector (Mouse) (pORF) |
ORF049934 |
ABM |
1.0 ug DNA |
EUR 506 |
Mcf2l ORF Vector (Mouse) (pORF) |
ORF049935 |
ABM |
1.0 ug DNA |
EUR 506 |
Mcf2l ORF Vector (Mouse) (pORF) |
ORF049936 |
ABM |
1.0 ug DNA |
EUR 506 |
Mcf2l ORF Vector (Rat) (pORF) |
ORF070369 |
ABM |
1.0 ug DNA |
EUR 506 |
MCF2L sgRNA CRISPR Lentivector set (Human) |
K1279201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mcf2l sgRNA CRISPR Lentivector set (Mouse) |
K5000801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mcf2l sgRNA CRISPR Lentivector set (Rat) |
K7057001 |
ABM |
3 x 1.0 ug |
EUR 339 |
MCF2L-AS1 ORF Vector (Human) (pORF) |
ORF023387 |
ABM |
1.0 ug DNA |
Ask for price |
MCF2L sgRNA CRISPR Lentivector (Human) (Target 1) |
K1279202 |
ABM |
1.0 ug DNA |
EUR 154 |
MCF2L sgRNA CRISPR Lentivector (Human) (Target 2) |
K1279203 |
ABM |
1.0 ug DNA |
EUR 154 |
MCF2L sgRNA CRISPR Lentivector (Human) (Target 3) |
K1279204 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5000802 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5000803 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5000804 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7057002 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7057003 |
ABM |
1.0 ug DNA |
EUR 154 |
Mcf2l sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7057004 |
ABM |
1.0 ug DNA |
EUR 154 |
MCF2L Protein Vector (Rat) (pPB-C-His) |
PV281474 |
ABM |
500 ng |
EUR 1191 |
MCF2L Protein Vector (Rat) (pPB-N-His) |
PV281475 |
ABM |
500 ng |
EUR 1191 |
MCF2L Protein Vector (Rat) (pPM-C-HA) |
PV281476 |
ABM |
500 ng |
EUR 1191 |
MCF2L Protein Vector (Rat) (pPM-C-His) |
PV281477 |
ABM |
500 ng |
EUR 1191 |
MCF2L Protein Vector (Human) (pPB-C-His) |
PV025289 |
ABM |
500 ng |
EUR 329 |
MCF2L Protein Vector (Human) (pPB-N-His) |
PV025290 |
ABM |
500 ng |
EUR 329 |
MCF2L Protein Vector (Human) (pPM-C-HA) |
PV025291 |
ABM |
500 ng |
EUR 329 |
MCF2L Protein Vector (Human) (pPM-C-His) |
PV025292 |
ABM |
500 ng |
EUR 329 |
MCF2L Protein Vector (Mouse) (pPB-C-His) |
PV199734 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPB-N-His) |
PV199735 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-HA) |
PV199736 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-His) |
PV199737 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPB-C-His) |
PV199738 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPB-N-His) |
PV199739 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-HA) |
PV199740 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-His) |
PV199741 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPB-C-His) |
PV199742 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPB-N-His) |
PV199743 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-HA) |
PV199744 |
ABM |
500 ng |
EUR 1065 |
MCF2L Protein Vector (Mouse) (pPM-C-His) |
PV199745 |
ABM |
500 ng |
EUR 1065 |
Mcf2l 3'UTR Luciferase Stable Cell Line |
TU212956 |
ABM |
1.0 ml |
Ask for price |
MCF2L 3'UTR Luciferase Stable Cell Line |
TU013112 |
ABM |
1.0 ml |
EUR 2333 |
MCF2L 3'UTR GFP Stable Cell Line |
TU063112 |
ABM |
1.0 ml |
EUR 2333 |
Mcf2l 3'UTR GFP Stable Cell Line |
TU262956 |
ABM |
1.0 ml |
Ask for price |
MCF2L Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV667747 |
ABM |
1.0 ug DNA |
EUR 1355 |
MCF2L Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV667751 |
ABM |
1.0 ug DNA |
EUR 1355 |
MCF2L Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV667752 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
MCF2L Rabbit Polyclonal Antibody