MOBP Rabbit Polyclonal Antibody
MOBP Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
MOBP Polyclonal Antibody |
A69599 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
MOBP Polyclonal Antibody |
ABP59303-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110 |
MOBP Polyclonal Antibody |
ABP59303-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110 |
MOBP Polyclonal Antibody |
ABP59303-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110 |
MOBP Polyclonal Antibody |
ES9837-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MOBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MOBP Polyclonal Antibody |
ES9837-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MOBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MOBP Rabbit pAb |
A3964-100ul |
Abclonal |
100 ul |
EUR 308 |
MOBP Rabbit pAb |
A3964-200ul |
Abclonal |
200 ul |
EUR 459 |
MOBP Rabbit pAb |
A3964-20ul |
Abclonal |
20 ul |
Ask for price |
MOBP Rabbit pAb |
A3964-50ul |
Abclonal |
50 ul |
Ask for price |
MOBP Rabbit pAb |
A17355-100ul |
Abclonal |
100 ul |
EUR 308 |
MOBP Rabbit pAb |
A17355-200ul |
Abclonal |
200 ul |
EUR 459 |
MOBP Rabbit pAb |
A17355-20ul |
Abclonal |
20 ul |
EUR 183 |
MOBP Rabbit pAb |
A17355-50ul |
Abclonal |
50 ul |
EUR 223 |
MOBP Polyclonal Conjugated Antibody |
C30023 |
SAB |
100ul |
EUR 397 |
MOBP antibody |
70R-18561 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MOBP antibody |
MOBP Antibody |
DF13155 |
Affbiotech |
200ul |
EUR 304 |
Description: MOBP Antibody detects endogenous levels of MOBP. |
MOBP Antibody |
1-CSB-PA014701GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MOBP Antibody |
1-CSB-PA014701LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Polyclonal MOBP Antibody (N-term) |
AMM06418G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOBP (N-term). This antibody is tested and proven to work in the following applications: |
MOBP Polyclonal Antibody, HRP Conjugated |
A69600 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
MOBP Polyclonal Antibody, FITC Conjugated |
A69601 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
MOBP Polyclonal Antibody, Biotin Conjugated |
A69602 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
anti- MOBP antibody |
FNab05262 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: myelin-associated oligodendrocyte basic protein
- Uniprot ID: Q13875
- Gene ID: 4336
- Research Area: Developmental biology
|
Description: Antibody raised against MOBP |
Anti-MOBP antibody |
STJ190995 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MOBP |
MOBP siRNA |
20-abx903300 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MOBP siRNA |
20-abx924370 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MOBP siRNA |
20-abx924371 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MOBP Antibody, HRP conjugated |
1-CSB-PA014701LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MOBP Antibody, FITC conjugated |
1-CSB-PA014701LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MOBP Antibody, Biotin conjugated |
1-CSB-PA014701LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MOBP Blocking Peptide |
DF13155-BP |
Affbiotech |
1mg |
EUR 195 |
MOBP cloning plasmid |
CSB-CL014701HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 246
- Sequence: atgagtcagaaaccggccaaggagggtcccagactctccaaaaaccagaagtactccgaacacttcagcatacactgctgcccgccgttcaccttcctcaattccaagaaggagatagtggatcggaaatacagcatctgtaagagcggctgcttctaccagaagaaagaggagga
- Show more
|
Description: A cloning plasmid for the MOBP gene. |
Anti-MOBP (1H3) |
YF-MA14268 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to MOBP |
Anti-MOBP (2F5) |
YF-MA14269 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to MOBP |
Anti-MOBP (4C2) |
YF-MA14270 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MOBP |
Rat MOBP shRNA Plasmid |
20-abx984752 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MOBP shRNA Plasmid |
20-abx952945 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MOBP shRNA Plasmid |
20-abx971545 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MOBP Recombinant Protein (Human) |
RP019690 |
ABM |
100 ug |
Ask for price |
MOBP Recombinant Protein (Mouse) |
RP151067 |
ABM |
100 ug |
Ask for price |
MOBP Recombinant Protein (Mouse) |
RP151070 |
ABM |
100 ug |
Ask for price |
MOBP Recombinant Protein (Mouse) |
RP151073 |
ABM |
100 ug |
Ask for price |
MOBP Rabbit Polyclonal Antibody