MOBP Rabbit Polyclonal Antibody

MOBP Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MOBP Polyclonal Antibody

A69599 100 ?g
EUR 628.55
Description: Ask the seller for details

MOBP Polyclonal Antibody

ABP59303-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110

MOBP Polyclonal Antibody

ABP59303-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110

MOBP Polyclonal Antibody

ABP59303-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOBP from Human, Mouse, Rat. This MOBP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOBP protein at amino acid sequence of 30-110

MOBP Polyclonal Antibody

ES9837-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MOBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOBP Polyclonal Antibody

ES9837-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MOBP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOBP Rabbit pAb

A3964-100ul 100 ul
EUR 308

MOBP Rabbit pAb

A3964-200ul 200 ul
EUR 459

MOBP Rabbit pAb

A3964-20ul 20 ul Ask for price

MOBP Rabbit pAb

A3964-50ul 50 ul Ask for price

MOBP Rabbit pAb

A17355-100ul 100 ul
EUR 308

MOBP Rabbit pAb

A17355-200ul 200 ul
EUR 459

MOBP Rabbit pAb

A17355-20ul 20 ul
EUR 183

MOBP Rabbit pAb

A17355-50ul 50 ul
EUR 223

MOBP Polyclonal Conjugated Antibody

C30023 100ul
EUR 397

MOBP antibody

70R-18561 50 ul
EUR 435
Description: Rabbit polyclonal MOBP antibody

MOBP Antibody

DF13155 200ul
EUR 304
Description: MOBP Antibody detects endogenous levels of MOBP.

MOBP Antibody

1-CSB-PA014701GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOBP Antibody

1-CSB-PA014701LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

Polyclonal MOBP Antibody (N-term)

AMM06418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOBP (N-term). This antibody is tested and proven to work in the following applications:

MOBP Polyclonal Antibody, HRP Conjugated

A69600 100 ?g
EUR 628.55
Description: The best epigenetics products

MOBP Polyclonal Antibody, FITC Conjugated

A69601 100 ?g
EUR 628.55
Description: kits suitable for this type of research

MOBP Polyclonal Antibody, Biotin Conjugated

A69602 100 ?g
EUR 628.55
Description: fast delivery possible

Mobp/ Rat Mobp ELISA Kit

ELI-15774r 96 Tests
EUR 886

anti- MOBP antibody

FNab05262 100µg
EUR 548.75
  • Immunogen: myelin-associated oligodendrocyte basic protein
  • Uniprot ID: Q13875
  • Gene ID: 4336
  • Research Area: Developmental biology
Description: Antibody raised against MOBP

Anti-MOBP antibody

PAab05262 100 ug
EUR 386

Anti-MOBP antibody

STJ24597 100 µl
EUR 277

Anti-MOBP antibody

STJ119481 100 µl
EUR 277

Anti-MOBP antibody

STJ190995 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOBP

MOBP siRNA

20-abx903300
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP siRNA

20-abx924370
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP siRNA

20-abx924371
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOBP Antibody, HRP conjugated

1-CSB-PA014701LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MOBP Antibody, FITC conjugated

1-CSB-PA014701LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MOBP Antibody, Biotin conjugated

1-CSB-PA014701LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MOBP. Recognizes MOBP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MOBP Blocking Peptide

DF13155-BP 1mg
EUR 195

MOBP cloning plasmid

CSB-CL014701HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 246
  • Sequence: atgagtcagaaaccggccaaggagggtcccagactctccaaaaaccagaagtactccgaacacttcagcatacactgctgcccgccgttcaccttcctcaattccaagaaggagatagtggatcggaaatacagcatctgtaagagcggctgcttctaccagaagaaagaggagga
  • Show more
Description: A cloning plasmid for the MOBP gene.

pBluescriptR-MOBP Plasmid

PVT14767 2 ug
EUR 325

Anti-MOBP (1H3)

YF-MA14268 200 ul
EUR 363
Description: Mouse monoclonal to MOBP

Anti-MOBP (2F5)

YF-MA14269 200 ul
EUR 363
Description: Mouse monoclonal to MOBP

Anti-MOBP (4C2)

YF-MA14270 100 ug
EUR 363
Description: Mouse monoclonal to MOBP

Mouse Mobp ELISA KIT

ELI-15773m 96 Tests
EUR 865

MOBP ELISA KIT|Human

EF000844 96 Tests
EUR 689

Rat MOBP shRNA Plasmid

20-abx984752
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MOBP shRNA Plasmid

20-abx952945
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MOBP shRNA Plasmid

20-abx971545
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MOBP ELISA KIT

ELI-38576h 96 Tests
EUR 824

MOBP Recombinant Protein (Human)

RP019690 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151067 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151070 100 ug Ask for price

MOBP Recombinant Protein (Mouse)

RP151073 100 ug Ask for price

MOBP Rabbit Polyclonal Antibody