MOG Rabbit Polyclonal Antibody

MOG Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MOG Polyclonal Antibody

ABP59304-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110

MOG Polyclonal Antibody

ES9838-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOG Polyclonal Antibody

ES9838-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-48T 48T
EUR 479
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Hu-96T 96T
EUR 621
  • Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-48T 48T
EUR 508
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

DLR-MOG-Ra-96T 96T
EUR 661
  • Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids.

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-48Tests 48 Tests
EUR 500

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Hu-96Tests 96 Tests
EUR 692

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-48Tests 48 Tests
EUR 534

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RDR-MOG-Ra-96Tests 96 Tests
EUR 742

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-48Tests 48 Tests
EUR 478

Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Hu-96Tests 96 Tests
EUR 662

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-48Tests 48 Tests
EUR 511

Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

RD-MOG-Ra-96Tests 96 Tests
EUR 709

MOG Rabbit pAb

A5353-100ul 100 ul
EUR 308

MOG Rabbit pAb

A5353-200ul 200 ul
EUR 459

MOG Rabbit pAb

A5353-20ul 20 ul
EUR 183

MOG Rabbit pAb

A5353-50ul 50 ul
EUR 223

Polyclonal MOG Antibody (Center)

AMM06421G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications:

Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-230-MOG 1 Kit
EUR 773

Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative

600-240-MOG 1 Kit
EUR 773

Polyclonal Goat Anti-MOG Antibody

AMM05945G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications:

Polyclonal MOG Antibody (aa163-174)

AMM06420G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications:

MOG antibody

70R-18564 50 ul
EUR 435
Description: Rabbit polyclonal MOG antibody

MOG Antibody

32793-100ul 100ul
EUR 252

MOG Antibody

1-CSB-PA619083ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MOG Antibody

DF7294 200ul
EUR 304
Description: MOG Antibody detects endogenous levels of total MOG.

MOG Antibody

1-CSB-PA014709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MOG Antibody

ABD7294 100 ug
EUR 438

MOG

GT15141 100 ug
EUR 526

Rabbit Anti-MOG ELISA Kit

ERTA0478 96Tests
EUR 521

MOG Conjugated Antibody

C32793 100ul
EUR 397

anti- MOG antibody

FNab05267 100µg
EUR 505.25
  • Immunogen: myelin oligodendrocyte glycoprotein
  • Uniprot ID: Q16653
  • Gene ID: 4340
  • Research Area: Neuroscience, Stem Cells, Immunology
Description: Antibody raised against MOG

Anti-MOG antibody

PAab05267 100 ug
EUR 355

Anti-MOG antibody

STJ27306 100 µl
EUR 277
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-MOG antibody

STJ70668 100 µg
EUR 359

Anti-MOG antibody

STJ190996 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MOG

MOG/ Rat MOG ELISA Kit

ELA-E0421r 96 Tests
EUR 886

MOG siRNA

20-abx924385
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MOG siRNA

20-abx924386
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)

4-PAA421Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly29~Gly153)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat)

4-PAA421Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MOG (Gly28~Gly152)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG)

Rabbit Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit

abx363767-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

MOG Blocking Peptide

DF7294-BP 1mg
EUR 195

MOG cloning plasmid

CSB-CL619083HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 888
  • Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa
  • Show more
Description: A cloning plasmid for the MOG gene.

MOG (35-55)

A8306-1 1 mg
EUR 163
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

MOG (35-55)

A8306-5 5 mg
EUR 390
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system.

pBluescriptR-MOG Plasmid

PVT17024 2 ug
EUR 325

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx004094
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103636
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Myelin Oligodendrocyte Glycoprotein (MOG) Antibody

20-abx103637
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MOG Rabbit Polyclonal Antibody