MOG Rabbit Polyclonal Antibody
MOG Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
MOG Polyclonal Antibody |
ABP59304-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of MOG from Human, Mouse, Rat. This MOG antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOG protein at amino acid sequence of 30-110 |
MOG Polyclonal Antibody |
ES9838-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MOG Polyclonal Antibody |
ES9838-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MOG from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
DLR-MOG-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
DLR-MOG-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates, cell lysates or other biological fluids. |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
DLR-MOG-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids. |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
DLR-MOG-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myelin Oligodendrocyte Glycoprotein (MOG) in samples from tissue homogenates or other biological fluids. |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RDR-MOG-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RDR-MOG-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RDR-MOG-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RDR-MOG-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RD-MOG-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RD-MOG-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RD-MOG-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
RD-MOG-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
MOG Rabbit pAb |
A5353-100ul |
Abclonal |
100 ul |
EUR 308 |
MOG Rabbit pAb |
A5353-200ul |
Abclonal |
200 ul |
EUR 459 |
MOG Rabbit pAb |
A5353-20ul |
Abclonal |
20 ul |
EUR 183 |
MOG Rabbit pAb |
A5353-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal MOG Antibody (Center) |
AMM06421G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (Center). This antibody is tested and proven to work in the following applications: |
Mouse Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative |
600-230-MOG |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Rat Anti-Myelin Oligodendrcyte protein (MOG) Ig's ELISA Kit, 96 tests, Quantitative |
600-240-MOG |
Alpha Diagnostics |
1 Kit |
EUR 773 |
Polyclonal Goat Anti-MOG Antibody |
AMM05945G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MOG . This antibody is tested and proven to work in the following applications: |
Polyclonal MOG Antibody (aa163-174) |
AMM06420G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOG (aa163-174). This antibody is tested and proven to work in the following applications: |
MOG antibody |
70R-18564 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MOG antibody |
MOG Antibody |
32793-100ul |
SAB |
100ul |
EUR 252 |
MOG Antibody |
1-CSB-PA619083ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against MOG. Recognizes MOG from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MOG Antibody |
DF7294 |
Affbiotech |
200ul |
EUR 304 |
Description: MOG Antibody detects endogenous levels of total MOG. |
MOG Antibody |
1-CSB-PA014709GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MOG. Recognizes MOG from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Rabbit Anti-MOG ELISA Kit |
ERTA0478 |
Abclonal |
96Tests |
EUR 521 |
MOG Conjugated Antibody |
C32793 |
SAB |
100ul |
EUR 397 |
anti- MOG antibody |
FNab05267 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: myelin oligodendrocyte glycoprotein
- Uniprot ID: Q16653
- Gene ID: 4340
- Research Area: Neuroscience, Stem Cells, Immunology
|
Description: Antibody raised against MOG |
Anti-MOG antibody |
STJ27306 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. |
Anti-MOG antibody |
STJ190996 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MOG |
MOG siRNA |
20-abx924385 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MOG siRNA |
20-abx924386 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat) |
4-PAA421Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MOG (Gly29~Gly153)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG) |
Myelin Oligodendrocyte Glycoprotein (MOG) Polyclonal Antibody (Mouse, Rat) |
4-PAA421Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MOG (Gly28~Gly152)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Myelin Oligodendrocyte Glycoprotein (MOG) |
Rabbit Myelin Oligodendrocyte Glycoprotein (MOG) ELISA Kit |
abx363767-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
MOG Blocking Peptide |
DF7294-BP |
Affbiotech |
1mg |
EUR 195 |
MOG cloning plasmid |
CSB-CL619083HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 888
- Sequence: atggcaagcttatcgagaccctctctgcccagctgcctctgctccttcctcctcctcctcctcctccaagtgtcttccagctatgcagggcagttcagagtgataggaccaagacaccctatccgggctctggtcggggatgaagtggaattgccatgtcgcatatctcctgggaa
- Show more
|
Description: A cloning plasmid for the MOG gene. |
MOG (35-55) |
A8306-1 |
ApexBio |
1 mg |
EUR 163 |
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system. |
MOG (35-55) |
A8306-5 |
ApexBio |
5 mg |
EUR 390 |
Description: MOG (35-55) is a truncated peptide derived from the human Myelin Oligodendrocyte Glycoprotein (MOG). MOG, a member of the immunoglobulin superfamily, is expressed wildly in the central nervous system. |
Myelin Oligodendrocyte Glycoprotein (MOG) Antibody |
20-abx004094 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Myelin Oligodendrocyte Glycoprotein (MOG) Antibody |
20-abx103636 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Myelin Oligodendrocyte Glycoprotein (MOG) Antibody |
20-abx103637 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MOG Rabbit Polyclonal Antibody