MTFR1 Rabbit Polyclonal Antibody
MTFR1 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
MTFR1 Polyclonal Antibody |
ABP59335-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of MTFR1 from Human, Mouse, Rat. This MTFR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTFR1 protein at amino acid sequence of 160-240 |
MTFR1 Polyclonal Antibody |
ES9809-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MTFR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MTFR1 Polyclonal Antibody |
ES9809-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MTFR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MTFR1 antibody |
70R-18659 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MTFR1 antibody |
MTFR1 Antibody |
36624-100ul |
SAB |
100ul |
EUR 252 |
MTFR1 Antibody |
1-CSB-PA782082 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
MTFR1 Antibody |
1-CSB-PA284832 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
MTFR1 Antibody |
1-CSB-PA015151GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against MTFR1. Recognizes MTFR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MTFR1 Conjugated Antibody |
C36624 |
SAB |
100ul |
EUR 397 |
anti- MTFR1 antibody |
FNab05398 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: mitochondrial fission regulator 1
- Uniprot ID: Q15390
- Gene ID: 9650
- Research Area: Metabolism, Cancer, Cell Division and Proliferation
|
Description: Antibody raised against MTFR1 |
Anti-MTFR1 antibody |
STJ190967 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MTFR1 |
MTFR1 siRNA |
20-abx903377 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MTFR1 siRNA |
20-abx924901 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MTFR1 siRNA |
20-abx924902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MTFR1 |
YF-PA16459 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MTFR1 |
MTFR1 cloning plasmid |
CSB-CL015151HU1-10ug |
Cusabio |
10ug |
EUR 390 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagcc
- Show more
|
Description: A cloning plasmid for the MTFR1 gene. |
MTFR1 cloning plasmid |
CSB-CL015151HU2-10ug |
Cusabio |
10ug |
EUR 390 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1002
- Sequence: atgcttggctggattaagcgcctaattaggatggtttttcaacaagttggagtaagcatgcaatcggtactttggtctaggaagccatatggttcgtctcgaagtatcgtaaggaaaattggtactaatttgtctctgattcagtgtccaagagttcagtttcagattaacagcc
- Show more
|
Description: A cloning plasmid for the MTFR1 gene. |
Rat MTFR1 shRNA Plasmid |
20-abx989671 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MTFR1 shRNA Plasmid |
20-abx976168 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MTFR1 shRNA Plasmid |
20-abx956427 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MTFR1 Rabbit Polyclonal Antibody