MUC15 Rabbit Polyclonal Antibody

MUC15 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MUC15 Polyclonal Antibody
ABP59340-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260 Applications tips:
Description: A polyclonal antibody for detection of MUC15 from Human, Mouse. This MUC15 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC15 protein at amino acid sequence of 180-260

MUC15 Polyclonal Antibody
ES9824-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MUC15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC15 Polyclonal Antibody
ES9824-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MUC15 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

MUC15 Antibody
35635-100ul	SAB	100ul	EUR 252

MUC15 Antibody
1-CSB-PA113113	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC15. Recognizes MUC15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC15 Antibody
1-CSB-PA141618	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC15. Recognizes MUC15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

MUC15 antibody
70R-6736	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MUC15 antibody raised against the middle region of MUC15

Polyclonal MUC15 Antibody (C-term)
APR03766G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUC15 (C-term). This antibody is tested and proven to work in the following applications:

MUC15 Conjugated Antibody
C35635	SAB	100ul	EUR 397

Anti-MUC15 antibody
STJ190982	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MUC15

MUC15 siRNA
20-abx925012	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUC15 siRNA
20-abx925013	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MUC15 Blocking Peptide
33R-4381	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MUC15 antibody, catalog no. 70R-6736

MUC15 cloning plasmid
CSB-CL822695HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1005 Sequence: atgttggccttagccaaaattctgttgatttcaacgttgttttattcacttctatcggggagccatggaaaagaaaatcaagacataaacacaacacagaacattgcagaagtttttaaaacaatggaaaataaacctatttctttggaaagtgaagcaaacttaaactcagata Show more
Description: A cloning plasmid for the MUC15 gene.

Human MUC15 ELISA Kit
ELA-E1074h	Lifescience Market	96 Tests	EUR 824

MUC15 ELISA KIT|Human
EF002736	Lifescience Market	96 Tests	EUR 689

Human MUC15 shRNA Plasmid
20-abx965379	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MUC15 shRNA Plasmid
20-abx983029	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MUC15 Recombinant Protein (Human)
RP020383	ABM	100 ug	Ask for price

MUC15 Recombinant Protein (Mouse)
RP152234	ABM	100 ug	Ask for price

MUC15 Recombinant Protein (Rat)
RP212771	ABM	100 ug	Ask for price

Mucin-15, Cell Surface Associated (MUC15) Antibody
abx027159-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody
abx027159-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody
20-abx210544	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Mucin-15, Cell Surface Associated (MUC15) Antibody
20-abx339442	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Muc15 ORF Vector (Rat) (pORF)
ORF070925	ABM	1.0 ug DNA	EUR 506

MUC15 ORF Vector (Human) (pORF)
ORF006795	ABM	1.0 ug DNA	EUR 95

Muc15 ORF Vector (Mouse) (pORF)
ORF050746	ABM	1.0 ug DNA	EUR 506

MUC15 ELISA Kit (Human) (OKEH04436)
OKEH04436	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May play a role in the cell adhesion to the extracellular matrix.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.1 ng/mL

MUC15 ELISA Kit (Mouse) (OKEH05708)
OKEH05708	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156 ng/mL

Human Mucin-15(MUC15) ELISA kit
CSB-EL015218HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-15 (MUC15) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mucin-15(MUC15) ELISA kit
1-CSB-EL015218HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mucin-15(MUC15) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human MUC15/ Mucin-15 ELISA Kit
E1666Hu	Sunlong	1 Kit	EUR 571

Human MUC15(Mucin-15) ELISA Kit
EH1209	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q8N387 Alias: MUC15/Mucin-15/MUC-15
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Mouse Mucin- 15, Muc15 ELISA KIT
ELI-03498m	Lifescience Market	96 Tests	EUR 865

Human Mucin- 15, MUC15 ELISA KIT
ELI-03499h	Lifescience Market	96 Tests	EUR 824

Bovine Mucin- 15, MUC15 ELISA KIT
ELI-03500b	Lifescience Market	96 Tests	EUR 928

Muc15 sgRNA CRISPR Lentivector set (Rat)
K6330001	ABM	3 x 1.0 ug	EUR 339

MUC15 Rabbit Polyclonal Antibody