MUC7 Rabbit Polyclonal Antibody

MUC7 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MUC7 Polyclonal Antibody
ES9828-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MUC7 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
MUC7 Polyclonal Antibody
ABP59345-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
MUC7 Polyclonal Antibody
ABP59345-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
MUC7 Polyclonal Antibody
ABP59345-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of MUC7 from Human. This MUC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MUC7 protein at amino acid sequence of 40-120
Human Mucin 7, Secreted (MUC7) ELISA Kit
DLR-MUC7-Hu-48T 48T
EUR 498
  • Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.
Human Mucin 7, Secreted (MUC7) ELISA Kit
DLR-MUC7-Hu-96T 96T
EUR 647
  • Should the Human Mucin 7, Secreted (MUC7) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 7, Secreted (MUC7) in samples from serum, plasma, saliva, tissue homogenates or other biological fluids.
Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-48Tests 48 Tests
EUR 500
Human Mucin 7, Secreted (MUC7) ELISA Kit
RD-MUC7-Hu-96Tests 96 Tests
EUR 692
Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-48Tests 48 Tests
EUR 522
Human Mucin 7, Secreted (MUC7) ELISA Kit
RDR-MUC7-Hu-96Tests 96 Tests
EUR 724
MUC7 Antibody
ABD9642 100 ug
EUR 438
MUC7 Antibody
43220-100ul 100ul
EUR 252
MUC7 Antibody
DF9642 200ul
EUR 304
Description: MUC7 Antibody detects endogenous levels of total MUC7.
MUC7 Antibody
1-CSB-PA949093
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
MUC7 Antibody
1-CSB-PA780399
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC7. Recognizes MUC7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:20-1:100
Rabbit MUC7 ELISA Kit
ERTM0361 96Tests
EUR 521
MUC7 Conjugated Antibody
C43220 100ul
EUR 397
Anti-MUC7 Antibody
A05210 100ug/vial
EUR 294
Anti-MUC7 antibody
STJ190986 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MUC7
MUC7 siRNA
20-abx925029
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-MUC7
YF-PA24185 50 ul
EUR 334
Description: Mouse polyclonal to MUC7
Mucin 7 (MUC7) Antibody
abx216981-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Mucin 7 (MUC7) Antibody
20-abx210446
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mucin 7 (MUC7) Antibody
20-abx210681
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rabbit Mucin-7, Secreted (MUC7) ELISA Kit
abx363009-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
MUC7 Blocking Peptide
DF9642-BP 1mg
EUR 195
MUC7 cloning plasmid
CSB-CL851529HU-10ug 10ug
EUR 427
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1134
  • Sequence: atgaaaactctgccgctgtttgtgtgcatctgtgcactgagtgcttgcttctcgttcagtgaaggtcgagaaagggatcatgaactacgtcacagaaggcatcatcaccaatcacccaaatctcactttgaattaccacattatcctggactgctagctcaccagaagccgttca
  • Show more
Description: A cloning plasmid for the MUC7 gene.
Anti-MUC7 (1C10)
YF-MA14331 100 ug
EUR 363
Description: Mouse monoclonal to MUC7
Anti-MUC7 (7F2)
YF-MA10594 100 ug
EUR 363
Description: Mouse monoclonal to MUC7
Mucin 7, Secreted (MUC7) Antibody
20-abx173632
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.
Mucin 7, Secreted (MUC7) Antibody
20-abx177629
  • EUR 1149.00
  • EUR 565.00
  • 1 mg
  • 200 ug
  • Please enquire.
Mucin 7, Secreted (MUC7) Antibody
20-abx177630
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human MUC7 ELISA Kit
EHM0361 96Tests
EUR 521
Human MUC7 ELISA Kit
ELA-E1808h 96 Tests
EUR 824
Goat MUC7 ELISA Kit
EGTM0361 96Tests
EUR 521
Bovine MUC7 ELISA Kit
EBM0361 96Tests
EUR 521
Chicken MUC7 ELISA Kit
ECKM0361 96Tests
EUR 521
Canine MUC7 ELISA Kit
ECM0361 96Tests
EUR 521
Anserini MUC7 ELISA Kit
EAM0361 96Tests
EUR 521
MUC7 ELISA KIT|Human
EF006051 96 Tests
EUR 689
Porcine MUC7 ELISA Kit
EPM0361 96Tests
EUR 521
Rat MUC7 ELISA Kit
ERM0361 96Tests
EUR 521

MUC7 Rabbit Polyclonal Antibody