MYEOV Rabbit Polyclonal Antibody
MYEOV Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 MYEOV Polyclonal Antibody |
|
ABP59359-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MYEOV protein at amino acid sequence of 80-160
- Applications tips:
|
|
Description: A polyclonal antibody for detection of MYEOV from Human. This MYEOV antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYEOV protein at amino acid sequence of 80-160 |
MYEOV Polyclonal Antibody |
|
ES9841-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MYEOV from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYEOV Polyclonal Antibody |
|
ES9841-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MYEOV from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 MYEOV antibody |
|
70R-18699 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MYEOV antibody |
 MYEOV Antibody |
|
DF13163 |
Affbiotech |
200ul |
EUR 304 |
|
Description: MYEOV Antibody detects endogenous levels of MYEOV. |
MYEOV Antibody |
|
1-CSB-PA015284GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MYEOV. Recognizes MYEOV from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
 anti- MYEOV antibody |
|
FNab05466 |
FN Test |
100µg |
EUR 585 |
- Immunogen: myeloma overexpressed(in a subset of t(11
- 14) positive multiple myelomas)
- Uniprot ID: Q96EZ4
- Gene ID: 26579
- Research Area: Cancer
|
|
Description: Antibody raised against MYEOV |
 Anti-MYEOV antibody |
|
STJ190999 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to MYEOV |
 MYEOV siRNA |
|
20-abx925130 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Antibody) Myeloma Overexpressed (MYEOV) Antibody |
|
20-abx113918 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myeloma Overexpressed (MYEOV) Antibody |
|
abx235466-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
 MYEOV Blocking Peptide |
|
DF13163-BP |
Affbiotech |
1mg |
EUR 195 |
 MYEOV cloning plasmid |
|
CSB-CL856930HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 942
- Sequence: atggccctcagaatctgcgtcacatacaccccagctctcccgataggtctctgcactcgctgttgcctctgcctggaacagtctccctcctggtgtcattgtctccgtggtgtgtccttcctgaccttccacctccaccagtctgtcccccttggggacagggactcgttgctcat
- Show more
|
|
Description: A cloning plasmid for the MYEOV gene. |
 Human MYEOV shRNA Plasmid |
|
20-abx958865 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MYEOV Recombinant Protein (Human) |
|
RP020470 |
ABM |
100 ug |
Ask for price |
 (pORF)) MYEOV ORF Vector (Human) (pORF) |
|
ORF006824 |
ABM |
1.0 ug DNA |
EUR 95 |
 ELISA Kit) Human Myeloma Overexpressed (MYEOV) ELISA Kit |
|
abx381630-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
) MYEOV sgRNA CRISPR Lentivector set (Human) |
|
K1373201 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) MYEOV sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1373202 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) MYEOV sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1373203 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) MYEOV sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1373204 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) MYEOV Protein Vector (Human) (pPB-C-His) |
|
PV027293 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) MYEOV Protein Vector (Human) (pPB-N-His) |
|
PV027294 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) MYEOV Protein Vector (Human) (pPM-C-HA) |
|
PV027295 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) MYEOV Protein Vector (Human) (pPM-C-His) |
|
PV027296 |
ABM |
500 ng |
EUR 329 |
 MYEOV 3'UTR GFP Stable Cell Line |
|
TU065027 |
ABM |
1.0 ml |
EUR 1394 |
 MYEOV 3'UTR Luciferase Stable Cell Line |
|
TU015027 |
ABM |
1.0 ml |
EUR 1394 |
 Human Myeloma- overexpressed gene protein, MYEOV ELISA KIT |
|
ELI-36862h |
Lifescience Market |
96 Tests |
EUR 824 |
) MYEOV sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
|
K1373205 |
ABM |
3 x 1.0 ug |
EUR 376 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
MYEOV Rabbit Polyclonal Antibody
