MYEOV Rabbit Polyclonal Antibody

MYEOV Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

MYEOV Polyclonal Antibody

ABP59359-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYEOV protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of MYEOV from Human. This MYEOV antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYEOV protein at amino acid sequence of 80-160

MYEOV Polyclonal Antibody

ES9841-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MYEOV from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYEOV Polyclonal Antibody

ES9841-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MYEOV from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MYEOV antibody

70R-18699 50 ul
EUR 435
Description: Rabbit polyclonal MYEOV antibody

MYEOV Antibody

DF13163 200ul
EUR 304
Description: MYEOV Antibody detects endogenous levels of MYEOV.

MYEOV Antibody

1-CSB-PA015284GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYEOV. Recognizes MYEOV from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti- MYEOV antibody

FNab05466 100µg
EUR 585
  • Immunogen: myeloma overexpressed(in a subset of t(11
  • 14) positive multiple myelomas)
  • Uniprot ID: Q96EZ4
  • Gene ID: 26579
  • Research Area: Cancer
Description: Antibody raised against MYEOV

Anti-MYEOV antibody

PAab05466 100 ug
EUR 412

Anti-MYEOV antibody

STJ190999 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MYEOV

MYEOV siRNA

20-abx925130
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Myeloma Overexpressed (MYEOV) Antibody

20-abx113918
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myeloma Overexpressed (MYEOV) Antibody

abx235466-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MYEOV Blocking Peptide

DF13163-BP 1mg
EUR 195

MYEOV cloning plasmid

CSB-CL856930HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 942
  • Sequence: atggccctcagaatctgcgtcacatacaccccagctctcccgataggtctctgcactcgctgttgcctctgcctggaacagtctccctcctggtgtcattgtctccgtggtgtgtccttcctgaccttccacctccaccagtctgtcccccttggggacagggactcgttgctcat
  • Show more
Description: A cloning plasmid for the MYEOV gene.

MYEOV ELISA KIT|Human

EF001019 96 Tests
EUR 689

Human MYEOV shRNA Plasmid

20-abx958865
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYEOV Recombinant Protein (Human)

RP020470 100 ug Ask for price

MYEOV ORF Vector (Human) (pORF)

ORF006824 1.0 ug DNA
EUR 95

Human Myeloma Overexpressed (MYEOV) ELISA Kit

abx381630-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MYEOV sgRNA CRISPR Lentivector set (Human)

K1373201 3 x 1.0 ug
EUR 339

MYEOV sgRNA CRISPR Lentivector (Human) (Target 1)

K1373202 1.0 ug DNA
EUR 154

MYEOV sgRNA CRISPR Lentivector (Human) (Target 2)

K1373203 1.0 ug DNA
EUR 154

MYEOV sgRNA CRISPR Lentivector (Human) (Target 3)

K1373204 1.0 ug DNA
EUR 154

MYEOV Protein Vector (Human) (pPB-C-His)

PV027293 500 ng
EUR 329

MYEOV Protein Vector (Human) (pPB-N-His)

PV027294 500 ng
EUR 329

MYEOV Protein Vector (Human) (pPM-C-HA)

PV027295 500 ng
EUR 329

MYEOV Protein Vector (Human) (pPM-C-His)

PV027296 500 ng
EUR 329

MYEOV 3'UTR GFP Stable Cell Line

TU065027 1.0 ml
EUR 1394

MYEOV 3'UTR Luciferase Stable Cell Line

TU015027 1.0 ml
EUR 1394

Human Myeloma- overexpressed gene protein, MYEOV ELISA KIT

ELI-36862h 96 Tests
EUR 824

MYEOV sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1373205 3 x 1.0 ug
EUR 376

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

MYEOV Rabbit Polyclonal Antibody