NEIL2 Rabbit Polyclonal Antibody
NEIL2 Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
 NEIL2 Polyclonal Antibody |
|
ABP59439-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NEIL2 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NEIL2 from Human, Mouse. This NEIL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NEIL2 protein |
 NEIL2 Antibody |
|
45969-100ul |
SAB |
100ul |
EUR 252 |
NEIL2 Antibody |
|
45969-50ul |
SAB |
50ul |
EUR 187 |
 NEIL2 antibody |
|
10R-1554 |
Fitzgerald |
100 ug |
EUR 512 |
|
Description: Mouse monoclonal NEIL2 antibody |
NEIL2 Antibody |
|
DF9499 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NEIL2 Antibody detects endogenous levels of total NEIL2. |
 NEIL2 Conjugated Antibody |
|
C45969 |
SAB |
100ul |
EUR 397 |
 Anti-NEIL2 antibody |
|
STJ190804 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to NEIL2 |
 NEIL2 siRNA |
|
20-abx925704 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEIL2 siRNA |
|
20-abx925705 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-NEIL2 |
|
YF-PA22799 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to NEIL2 |
anti-NEIL2 |
|
YF-PA22800 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to NEIL2 |
anti-NEIL2 |
|
YF-PA22801 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to NEIL2 |
 NEIL2 Blocking Peptide |
|
20-abx161176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NEIL2 Blocking Peptide |
|
DF9499-BP |
Affbiotech |
1mg |
EUR 195 |
 NEIL2 cloning plasmid |
|
CSB-CL846576HU-10ug |
Cusabio |
10ug |
EUR 390 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 999
- Sequence: atgccagaagggccgttggtgaggaaatttcaccatttggtctccccctttgtgggtcagcaggtggtcaagacagggggcagcagtaagaagctacagcccgccagcctgcagtctctgtggctccaggacacccaggtccatggaaagaaattattccttagatttgatctaga
- Show more
|
|
Description: A cloning plasmid for the NEIL2 gene. |
) Anti-NEIL2 (1B7) |
|
YF-MA20059 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to NEIL2 |
 Mouse NEIL2 shRNA Plasmid |
|
20-abx983907 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NEIL2 protein (His tag) |
|
80R-2266 |
Fitzgerald |
50 ug |
EUR 424 |
|
Description: Purified recombinant Human NEIL2 Protein (His tag) |
 Human NEIL2 shRNA Plasmid |
|
20-abx966629 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NEIL2 Recombinant Protein (Human) |
|
RP021055 |
ABM |
100 ug |
Ask for price |
) NEIL2 Recombinant Protein (Rat) |
|
RP213653 |
ABM |
100 ug |
Ask for price |
) NEIL2 Recombinant Protein (Mouse) |
|
RP153632 |
ABM |
100 ug |
Ask for price |
 Antibody) Endonuclease 8-Like 2 (NEIL2) Antibody |
|
20-abx121176 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Endonuclease 8-Like 2 (NEIL2) Antibody |
|
abx028552-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Endonuclease 8-Like 2 (NEIL2) Antibody |
|
abx028552-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Endonuclease 8-Like 2 (NEIL2) Antibody |
|
20-abx217106 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) NEIL2 ORF Vector (Human) (pORF) |
|
ORF007019 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Neil2 ORF Vector (Rat) (pORF) |
|
ORF071219 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Neil2 ORF Vector (Mouse) (pORF) |
|
ORF051212 |
ABM |
1.0 ug DNA |
EUR 506 |
) NEIL2 sgRNA CRISPR Lentivector set (Human) |
|
K1416001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Neil2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3567601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Neil2 sgRNA CRISPR Lentivector set (Rat) |
|
K7616601 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NEIL2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1416002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NEIL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1416003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NEIL2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1416004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3567602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3567603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3567604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Neil2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7616602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Neil2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7616603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Neil2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7616604 |
ABM |
1.0 ug DNA |
EUR 154 |
 Recombinant Human NEIL2 Protein, His, E.coli-10ug |
|
QP12826-10ug |
EnQuireBio |
10ug |
EUR 201 |
 Recombinant Human NEIL2 Protein, His, E.coli-1mg |
|
QP12826-1mg |
EnQuireBio |
1mg |
EUR 5251 |
 Recombinant Human NEIL2 Protein, His, E.coli-2ug |
|
QP12826-2ug |
EnQuireBio |
2ug |
EUR 155 |
 (pPB-C-His)) NEIL2 Protein Vector (Rat) (pPB-C-His) |
|
PV284874 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NEIL2 Protein Vector (Rat) (pPB-N-His) |
|
PV284875 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NEIL2 Protein Vector (Rat) (pPM-C-HA) |
|
PV284876 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NEIL2 Protein Vector (Rat) (pPM-C-His) |
|
PV284877 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NEIL2 Protein Vector (Human) (pPB-C-His) |
|
PV028073 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NEIL2 Protein Vector (Human) (pPB-N-His) |
|
PV028074 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NEIL2 Protein Vector (Human) (pPM-C-HA) |
|
PV028075 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NEIL2 Protein Vector (Human) (pPM-C-His) |
|
PV028076 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) NEIL2 Protein Vector (Mouse) (pPB-C-His) |
|
PV204846 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NEIL2 Protein Vector (Mouse) (pPB-N-His) |
|
PV204847 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NEIL2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV204848 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NEIL2 Protein Vector (Mouse) (pPM-C-His) |
|
PV204849 |
ABM |
500 ng |
EUR 603 |
 Neil2 3'UTR GFP Stable Cell Line |
|
TU163981 |
ABM |
1.0 ml |
Ask for price |
 Neil2 3'UTR Luciferase Stable Cell Line |
|
TU213879 |
ABM |
1.0 ml |
Ask for price |
 NEIL2 3'UTR Luciferase Stable Cell Line |
|
TU015563 |
ABM |
1.0 ml |
EUR 1394 |
Neil2 3'UTR Luciferase Stable Cell Line |
|
TU113981 |
ABM |
1.0 ml |
Ask for price |
 NEIL2 3'UTR GFP Stable Cell Line |
|
TU065563 |
ABM |
1.0 ml |
EUR 1394 |
Neil2 3'UTR GFP Stable Cell Line |
|
TU263879 |
ABM |
1.0 ml |
Ask for price |
 Bovine Endonuclease 8- like 2, NEIL2 ELISA KIT |
|
ELI-13798b |
Lifescience Market |
96 Tests |
EUR 928 |
 Mouse Endonuclease 8- like 2, Neil2 ELISA KIT |
|
ELI-13799m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Endonuclease 8- like 2, NEIL2 ELISA KIT |
|
ELI-42479h |
Lifescience Market |
96 Tests |
EUR 824 |
 (CMV) (pLenti-GIII-CMV)) NEIL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV640309 |
ABM |
1.0 ug DNA |
EUR 514 |
 (UbC) (pLenti-GIII-UbC)) NEIL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV640313 |
ABM |
1.0 ug DNA |
EUR 514 |
 (EF1a) (pLenti-GIII-EF1a)) NEIL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV640314 |
ABM |
1.0 ug DNA |
EUR 514 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NEIL2 Rabbit Polyclonal Antibody
