NEIL2 Rabbit Polyclonal Antibody

NEIL2 Rabbit Polyclonal Antibody

Order Now: info@kwalshlab.org

NEIL2 Polyclonal Antibody

ES9646-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NEIL2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEIL2 antibody

10R-1554 100 ug
EUR 512
Description: Mouse monoclonal NEIL2 antibody

NEIL2 Antibody

45969-100ul 100ul
EUR 252

NEIL2 Antibody

45969-50ul 50ul
EUR 187

NEIL2 Antibody

DF9499 200ul
EUR 304
Description: NEIL2 Antibody detects endogenous levels of total NEIL2.

NEIL2 Antibody

ABD9499 100 ug
EUR 438

NEIL2 Conjugated Antibody

C45969 100ul
EUR 397

Anti-NEIL2 antibody

STJ190804 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NEIL2

NEIL2 siRNA

20-abx925704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEIL2 siRNA

20-abx925705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-NEIL2

YF-PA22799 50 ul
EUR 363
Description: Mouse polyclonal to NEIL2

anti-NEIL2

YF-PA22800 100 ul
EUR 403
Description: Rabbit polyclonal to NEIL2

anti-NEIL2

YF-PA22801 100 ug
EUR 403
Description: Rabbit polyclonal to NEIL2

NEIL2 Blocking Peptide

DF9499-BP 1mg
EUR 195

NEIL2 Blocking Peptide

20-abx161176
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

NEIL2 cloning plasmid

CSB-CL846576HU-10ug 10ug
EUR 390
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 999
  • Sequence: atgccagaagggccgttggtgaggaaatttcaccatttggtctccccctttgtgggtcagcaggtggtcaagacagggggcagcagtaagaagctacagcccgccagcctgcagtctctgtggctccaggacacccaggtccatggaaagaaattattccttagatttgatctaga
  • Show more
Description: A cloning plasmid for the NEIL2 gene.

Anti-NEIL2 (1B7)

YF-MA20059 100 ug
EUR 363
Description: Mouse monoclonal to NEIL2

NEIL2 protein (His tag)

80R-2266 50 ug
EUR 424
Description: Purified recombinant Human NEIL2 Protein (His tag)

Human NEIL2 shRNA Plasmid

20-abx966629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NEIL2 shRNA Plasmid

20-abx983907
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEIL2 Recombinant Protein (Human)

RP021055 100 ug Ask for price

NEIL2 Recombinant Protein (Mouse)

RP153632 100 ug Ask for price

NEIL2 Recombinant Protein (Rat)

RP213653 100 ug Ask for price

Endonuclease 8-Like 2 (NEIL2) Antibody

20-abx217106
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

20-abx121176
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

abx028552-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Endonuclease 8-Like 2 (NEIL2) Antibody

abx028552-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neil2 ORF Vector (Rat) (pORF)

ORF071219 1.0 ug DNA
EUR 506

NEIL2 ORF Vector (Human) (pORF)

ORF007019 1.0 ug DNA
EUR 95

Neil2 ORF Vector (Mouse) (pORF)

ORF051212 1.0 ug DNA
EUR 506

Neil2 sgRNA CRISPR Lentivector set (Rat)

K7616601 3 x 1.0 ug
EUR 339

Neil2 sgRNA CRISPR Lentivector set (Mouse)

K3567601 3 x 1.0 ug
EUR 339

NEIL2 sgRNA CRISPR Lentivector set (Human)

K1416001 3 x 1.0 ug
EUR 339

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7616602 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7616603 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7616604 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3567602 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3567603 1.0 ug DNA
EUR 154

Neil2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3567604 1.0 ug DNA
EUR 154

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1416002 1.0 ug DNA
EUR 154

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1416003 1.0 ug DNA
EUR 154

NEIL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1416004 1.0 ug DNA
EUR 154

NEIL2 Protein Vector (Mouse) (pPB-C-His)

PV204846 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPB-N-His)

PV204847 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPM-C-HA)

PV204848 500 ng
EUR 603

NEIL2 Protein Vector (Mouse) (pPM-C-His)

PV204849 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPB-C-His)

PV284874 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPB-N-His)

PV284875 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPM-C-HA)

PV284876 500 ng
EUR 603

NEIL2 Protein Vector (Rat) (pPM-C-His)

PV284877 500 ng
EUR 603

NEIL2 Protein Vector (Human) (pPB-C-His)

PV028073 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPB-N-His)

PV028074 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPM-C-HA)

PV028075 500 ng
EUR 329

NEIL2 Protein Vector (Human) (pPM-C-His)

PV028076 500 ng
EUR 329

Recombinant Human NEIL2 Protein, His, E.coli-10ug

QP12826-10ug 10ug
EUR 201

Recombinant Human NEIL2 Protein, His, E.coli-1mg

QP12826-1mg 1mg
EUR 5251

Recombinant Human NEIL2 Protein, His, E.coli-2ug

QP12826-2ug 2ug
EUR 155

Neil2 3'UTR Luciferase Stable Cell Line

TU113981 1.0 ml Ask for price

Neil2 3'UTR GFP Stable Cell Line

TU163981 1.0 ml Ask for price

Neil2 3'UTR Luciferase Stable Cell Line

TU213879 1.0 ml Ask for price

Neil2 3'UTR GFP Stable Cell Line

TU263879 1.0 ml Ask for price

NEIL2 3'UTR GFP Stable Cell Line

TU065563 1.0 ml
EUR 1394

NEIL2 3'UTR Luciferase Stable Cell Line

TU015563 1.0 ml
EUR 1394

Bovine Endonuclease 8- like 2, NEIL2 ELISA KIT

ELI-13798b 96 Tests
EUR 928

Mouse Endonuclease 8- like 2, Neil2 ELISA KIT

ELI-13799m 96 Tests
EUR 865

Human Endonuclease 8- like 2, NEIL2 ELISA KIT

ELI-42479h 96 Tests
EUR 824

NEIL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640309 1.0 ug DNA
EUR 514

NEIL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640313 1.0 ug DNA
EUR 514

NEIL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640314 1.0 ug DNA
EUR 514

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

NEIL2 Rabbit Polyclonal Antibody