PDS5B Rabbit Polyclonal Antibody
PDS5B Rabbit Polyclonal Antibody
Order Now: info@kwalshlab.org
PDS5B Polyclonal Antibody |
ABP59872-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDS5B protein at amino acid sequence of 90-170
- Applications tips:
|
Description: A polyclonal antibody for detection of PDS5B from Human, Mouse, Rat. This PDS5B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDS5B protein at amino acid sequence of 90-170 |
PDS5B Rabbit pAb |
A19504-100ul |
Abclonal |
100 ul |
Ask for price |
PDS5B Rabbit pAb |
A19504-200ul |
Abclonal |
200 ul |
Ask for price |
PDS5B Rabbit pAb |
A19504-20ul |
Abclonal |
20 ul |
Ask for price |
PDS5B Rabbit pAb |
A19504-50ul |
Abclonal |
50 ul |
EUR 308 |
PDS5B antibody |
70R-2864 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PDS5B antibody |
PDS5B Antibody |
36260-100ul |
SAB |
100ul |
EUR 252 |
PDS5B antibody |
70R-19197 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PDS5B antibody |
PDS5B Antibody |
DF9206 |
Affbiotech |
200ul |
EUR 304 |
Description: PDS5B Antibody detects endogenous levels of total PDS5B. |
PDS5B Antibody |
1-CSB-PA889108LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
PDS5B Antibody |
1-CSB-PA243039 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000 |
PDS5B Antibody |
1-CSB-PA017743GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal PDS5B Antibody (C-Term) |
APR04963G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDS5B (C-Term). This antibody is tested and proven to work in the following applications: |
PDS5B Conjugated Antibody |
C36260 |
SAB |
100ul |
EUR 397 |
anti- PDS5B antibody |
FNab06291 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: PDS5, regulator of cohesion maintenance, homolog B(S. cerevisiae)
- Uniprot ID: Q9NTI5
- Gene ID: 23047
- Research Area: Cell Division and Proliferation, Developmental biology
|
Description: Antibody raised against PDS5B |
Anti-PDS5B antibody |
STJ11100697 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. |
Anti-PDS5B antibody |
STJ190546 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PDS5B |
PDS5B siRNA |
20-abx928178 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDS5B siRNA |
20-abx928179 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDS5B Antibody, HRP conjugated |
1-CSB-PA889108LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PDS5B Antibody, FITC conjugated |
1-CSB-PA889108LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PDS5B Antibody, Biotin conjugated |
1-CSB-PA889108LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PDS5B. Recognizes PDS5B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PDS5B Blocking Peptide |
33R-1917 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDS5B antibody, catalog no. 70R-2864 |
PDS5B Blocking Peptide |
DF9206-BP |
Affbiotech |
1mg |
EUR 195 |
PDS5B cloning plasmid |
CSB-CL889108HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1590
- Sequence: atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacc
- Show more
|
Description: A cloning plasmid for the PDS5B gene. |
PDS5B cloning plasmid |
CSB-CL889108HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 369
- Sequence: atggctcattcaaagactaggaccaatgatggaaaaattacatatccgcctggggtcaaggaaatatcagataaaatatctaaagaggagatggtgagacgattaaagatggttgtgaaaacttttatggatatggaccaggactctgaagaagaaaaggagctttatttaaacct
- Show more
|
Description: A cloning plasmid for the PDS5B gene. |
Mouse PDS5B shRNA Plasmid |
20-abx979459 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PDS5B shRNA Plasmid |
20-abx957958 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody |
20-abx124222 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (Pds5b) Antibody |
20-abx114352 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody |
20-abx214301 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody |
abx340056-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody |
20-abx316624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody |
abx236291-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
PDS5B ORF Vector (Human) (pORF) |
ORF007667 |
ABM |
1.0 ug DNA |
EUR 95 |
PDS5B ORF Vector (Human) (pORF) |
ORF007668 |
ABM |
1.0 ug DNA |
EUR 95 |
Pds5b ORF Vector (Rat) (pORF) |
ORF073316 |
ABM |
1.0 ug DNA |
EUR 2080 |
Pds5b ORF Vector (Rat) (pORF) |
ORF073317 |
ABM |
1.0 ug DNA |
EUR 2080 |
Pds5b ORF Vector (Mouse) (pORF) |
ORF053728 |
ABM |
1.0 ug DNA |
EUR 1572 |
PDS5 Cohesin Associated Factor B (PDS5B) Antibody (HRP) |
20-abx316625 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody (FITC) |
20-abx316626 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PDS5 Cohesin Associated Factor B (PDS5B) Antibody (Biotin) |
20-abx316627 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit |
E04S0341-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit |
E04S0341-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) ELISA kit |
E04S0341-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Sister chromatid cohesion protein PDS5 homolog B(PDS5B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PDS5B sgRNA CRISPR Lentivector set (Human) |
K1623601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pds5b sgRNA CRISPR Lentivector set (Mouse) |
K4979001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pds5b sgRNA CRISPR Lentivector set (Rat) |
K7346801 |
ABM |
3 x 1.0 ug |
EUR 339 |
PDS5B sgRNA CRISPR Lentivector (Human) (Target 1) |
K1623602 |
ABM |
1.0 ug DNA |
EUR 154 |
PDS5B sgRNA CRISPR Lentivector (Human) (Target 2) |
K1623603 |
ABM |
1.0 ug DNA |
EUR 154 |
PDS5B sgRNA CRISPR Lentivector (Human) (Target 3) |
K1623604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4979002 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4979003 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4979004 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7346802 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7346803 |
ABM |
1.0 ug DNA |
EUR 154 |
Pds5b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7346804 |
ABM |
1.0 ug DNA |
EUR 154 |
PDS5B Protein Vector (Human) (pPB-C-His) |
PV030665 |
ABM |
500 ng |
EUR 329 |
PDS5B Protein Vector (Human) (pPB-N-His) |
PV030666 |
ABM |
500 ng |
EUR 329 |
PDS5B Protein Vector (Human) (pPM-C-HA) |
PV030667 |
ABM |
500 ng |
EUR 329 |
PDS5B Protein Vector (Human) (pPM-C-His) |
PV030668 |
ABM |
500 ng |
EUR 329 |
PDS5B Protein Vector (Human) (pPB-C-His) |
PV030669 |
ABM |
500 ng |
EUR 329 |
PDS5B Protein Vector (Human) (pPB-N-His) |
PV030670 |
ABM |
500 ng |
EUR 329 |
PDS5B Rabbit Polyclonal Antibody